Table 3. Virome sequences showing silent or conservative changes relative to the viritope Cluster_2_YMBCR81TF-SP-2 sequence.
| Sequence identifier | Nucleic Acid Sequence | %NAID | Predicated AA Sequence | % AASIM/AAID |
| Viritope | AGTTTACCCTCAAGTGGGAAGGCGGCTTTGTCCACCATCC | FTLKWEGGFVHH | ||
| Y_1647173811 | ..........T...........T................. | 95 | ............ | 100/100 |
| Y_1647170208 | ..........T...........T................. | 95 | ............ | 100/100 |
| Y_1647175271 | .......T..T...........T................. | 92 | ............ | 100/100 |
| Y_1647164556 | .......T..T...........T................. | 92 | ............ | 100/100 |
| Y_1647162994 | ..........T...........T....A............ | 92 | ........Y... | 100/91 |
| B_1647183951-RC | ........T.GCGC.....G..T....AC..GA....C.. | 70 | ...R....Y.N. | 100/75 |
| B_1647183950 | ........T.GCGC.....G..T....AC..GA....C.. | 70 | ...R....Y.N. | 100/75 |
| B_1647178644 | ........T.GCGC.....G..T....AC..GA....C.. | 70 | ...R....Y.N. | 100/75 |
| B_1647170869 | ........T.GCGC.....G..T....AC..GA....C.. | 70 | ...R....Y.N. | 100/75 |
| B_1647170868-RC | ........T.GCGC.....G..T....AC..GA....C.. | 70 | ...R....Y.N. | 100/75 |
| B_1647166765 | ........T.GCGC.....G..T....AC..GA....C.. | 70 | ...R....Y.N. | 100/75 |
| B_1647165544-RC | ........T.GCGC.....G..T....AC..GA....C.. | 70 | ...R....Y.N. | 100/75 |
| P_1647167058 | ....C.....G..A........G..G...........C.. | 86 | ............ | 100/100 |
| P_1647166181 | .A.................G.....G.AC..AA.T..... | 80 | ........Y.N. | 100/83 |
| P_1647164597 | .A.................G.....G.AC..AA.T..... | 80 | ........Y.N. | 100/83 |
| P_1647164475 | .A.................G.....G.AC..AA.T..... | 80 | ........Y.N. | 100/83 |
| P_1647164033 | .A.................G.....G.AC..AA.T..... | 80 | ........Y.N. | 100/83 |
| P_1647163511 | .A.................G.....G.AC..AA.T..... | 80 | ........Y.N. | 100/83 |
| P_1647173178 | .C.....A..A..A........T..T.AC..AA....C.. | 75 | ........Y.N. | 100/83 |
| P_1647166871 | .C.....A..A..A.....G..T..G.AC..AA....C.. | 73 | ........Y.N. | 100/83 |
| P_1647162773 | .C.....A..A..A.....G..T..G.AC..AA....C.. | 73 | ........Y.N. | 100/83 |
| P_1647183575 | ........T.GCGC.....G..T....AC..GA....C.. | 70 | ...R....Y.N. | 100/75 |
| P_1647183574 | ........T.GCGC.....G..T....AC..GA....C.. | 70 | ...R....Y.N. | 100/75 |
Nucleic Acid Sequences. The viritope sequence is in Line 1. Matching sequences from the virome are shown below. Identical nucleotides are shown as a “.”. Nucleotides in regular and bold text indicate synonymous and non-synonymous changes, respectively, relative to the viritope sequence. Nucleotides in italics indicate SNPs which cannot be assigned a specific amino acid translation since the sequences have been translated in the +3 frame, thus the first base of the codon is missing. Sequence identifier prefixes indicate the method used to find them: ‘Y’–virome sequence with high NAID to CRISPR_II_YMBCR81TF-SP-2; ‘B’–virome sequence with high NAID to CRISPR_II_YMIA938TF-SP-4/5; ‘P’–amino acid similarity to translations of ‘Y’ and ‘B’ sequences. ‘RC’ indicates that the sequence shown is the reverse complement of the database entry. NAID of the virome sequences to the viritope are shown. For the predicted amino acid (AA) sequence of the viritope and virome sequences which have been translated starting from nucleotide position #3. Percent similarity (SIM) and identity (ID) of amino acids to the translated amino acids of the viritope are shown at extreme right. Identical amino acids are shown as a “.”. Those AAs that differ from the viritope AA sequence are shown, and represent conservative changes.