Figure 3.
RNA footprinting. (A) RNA–protein complexes, formed in the presence of 32P-labeled Vg1 localization transcript and nonspecific (nsp., lane 1) or specific (sp., lane 2) competitor RNAs, were treated with T1 RNase. An autoradiogram of a nondenaturing gel is shown, and the RNase-resistant complexes are labeled A–D at the left. (B) The RNA fragments from complexes A–D were resolved on a 15% polyacrylamide gel. An autoradiogram is shown, with the sizes of RNA molecular weight markers (lane M) listed at the left. The sequences of the RNA fragments are: A and B = UUAAUAAUAAUAUCUUAG; C = ACUUUUCUAUUUCACUAAAAUUAG; and D = auccccAUUUCUACUUUAUUUCUACACUG. The first six nt of fragment D are polylinker sequences (lowercase letters), whereas the remaining 23 nt are the 5′ end of the Vg1 localization element.