TABLE 1.
Oligonucleotide probes used in this study
| Probe | Specificity | Probe sequence (5′-3′) | Target site 16S or 23S rRNA position (nucleotide) | % FAa | Source or reference |
|---|---|---|---|---|---|
| NON338 | ACTCCTACGGGAGGCAGC | 16S (338-355) | 0 | 64 | |
| EUB338 | Bacteria | GCTGCCTCCCGTAGGAGT | 16S (338-355) | 35 | 2 |
| ALF968 | α-Proteobacteria | GGTAAGGTTCTGCGCGTT | 16S (968-985) | 20 | 49 |
| SPH120 | Sphingomonas spp. | GGGCAGATTCCCACGCGT | 16S (120-137) | 30 | 49 |
| ROSEO536 | Roseobacter clade | CAACGCTAACCCCCTCCG | 16S (536-553) | 20 | 16 |
| ODB1021 | Octadecabacter spp. | GCGTCCCCTAAGGGAACT | 16S (1021-1038) | 15 | This study |
| RSHP995 | Roseobacter sp. strain Shippagan group | CTCGGATTGTCCAGGCAT | 16S (995-1012) | 10 | This study |
| BET42a | β-Proteobacteria | GCCTTCCCACTTCGTTT | 23S (1027-1043) | 35 | 44 |
| GAM42a | γ-Proteobacteria | GCCTTCCCACATCGTTT | 23S (1027-1043) | 35 | 44 |
| ALT1413 | Alteromonas-Colwellia | TTTGCATCCCACTCCCAT | 16S (1413-1430) | 40 | 23 |
| PSA184 | Pseudoalteromonas-Colwellia | CCCCTTTGGTCCGTAGAC | 16S (184-210) | 30 | 23 |
| GPU622 | Glaciecola punicea | CTAAAAGGCCTTCCCACG | 16S (622-639) | 17 | This study |
| GVstr214b | Glaciecola sp. strain GVstr214.6 | CTAAATGCTATTCCCAGG | 16S (622-639) | 12 | This study |
| GVstr214c | Competitor for GVstr214 | CCAAATGCTATTCCCAGG | 16S (622-639) | 12 | This study |
| NOR2-1453 | Psychromonas spp. | GGTCATCGCCATCCCC | 16S (1453-1468) | 30 | 23 |
| SF825 | Shewanella frigidimarina | AAGTCACCAAACTCCGAG | 16S (825-842) | 10 | This study |
| PSYB476 | Psychrobacter spp. | CTGCAGCTAATGTCATCG | 16S (476-493) | 10 | This study |
| MB-IC022b | Marinobacter sp. strain IC022 group | GTTTCCGCCCGACTTGCA | 16S (55-72) | 25 | This study |
| MB-IC022c | Competitor for MB-IC022 | GTTTCCGCTCGACTTGCA | 16S (55-72) | 25 | This study |
| G V | Vibrio spp. | AGGCCACAACCTCCAAGTAG | 16S (822-841) | 30 | 26 |
| OCE232 | Oceanospirillum spp. | AGCTAATCTCACGCAGGC | 16S (232-249) | 40 | 23 |
| PS56a | True Pseudomonas spp. | GCTGGCCTAGCCTTC | 23S (1432-1446) | 0 | 55 |
| CF319a | CF group | TGGTCCGTGTCTCAGTAC | 16S (319-336) | 35 | 43 |
| PB223b | Polaribacter spp. | GGACGCATAGCCATCTTT | 16S (223-240) | 15 | This study |
| PB223c | Competitor for PB223 | GAACGCATAGCCATCTTT | 16S (223-240) | 15 | This study |
| HGC69a | Gram positive (Actinobacteria) | TATAGTTACCACCGCCGT | 23S (1901-1918) | 25 | 53 |
| PLA46 | Planctomycetales | GACTTGCATGCCTAATCC | 16S (46-63) | 30 | 50 |
| ARCH915 | Archaea | GTGCTCCCCCGCCAATTCCT | 16S (915-934) | 20 | 59 |
a
Values represent percent formamide in the hybridization buffer.
b
Probes GVstr214, MB-IC022, and PB223 were used with competitors GVstr214c, MBIC022c, and PB223c, respectively.