TABLE 1.
SST and SSTR1–5 mRNA expression in control and Sst−/− islets
| Primer sequence | Product (bp) | Tann (C°) | mRNA expression
|
||
|---|---|---|---|---|---|
| Sst+/+ | Sst−/− | ||||
| SST | F: ccagactccgtcagtttc | 124 | 56 | + | − |
| R: gctccagggcatcattct | |||||
| SSTR1 | F: ttttgtcatctgctggatgc | 167 | 59.9 | + | + |
| R: ggaaagagcgcttgaagttg | |||||
| SSTR2 | F: acgccaagatgaagaccatc | 197 | 55.7 | + | + |
| R: catgaccgtcaagcagaaga | |||||
| SSTR3 | F: tggtgatctacgtggtcctg | 163 | 59.9 | + | + |
| R: agacggcacatgagagatcc | |||||
| SSTR4 | F: tgctaactgctggcatgaag | 154 | 59.9 | + | + |
| R: ttcagcactgacaccaggag | |||||
| SSTR5 | F: cgacttcgtacagcaatcca | 213 | 58 | + | + |
| R: ctcacagaggttggctcaca | |||||
SST mRNA was detected by RT-PCR in control but not in Sst−/− mouse islet extracts, confirming the absence of endogenous δ-cell SST in Sst−/− mice. SSTR1–5 mRNAs were identified in both control and Sst−/− islet extracts. F, forward primer, R, reverse primer.