Skip to main content
. 2009 Feb;58(2):403–411. doi: 10.2337/db08-0792

TABLE 1.

SST and SSTR1–5 mRNA expression in control and Sst−/− islets

Primer sequence Product (bp) Tann (C°) mRNA expression
Sst+/+ Sst−/−
SST F: ccagactccgtcagtttc 124 56 +
R: gctccagggcatcattct
SSTR1 F: ttttgtcatctgctggatgc 167 59.9 + +
R: ggaaagagcgcttgaagttg
SSTR2 F: acgccaagatgaagaccatc 197 55.7 + +
R: catgaccgtcaagcagaaga
SSTR3 F: tggtgatctacgtggtcctg 163 59.9 + +
R: agacggcacatgagagatcc
SSTR4 F: tgctaactgctggcatgaag 154 59.9 + +
R: ttcagcactgacaccaggag
SSTR5 F: cgacttcgtacagcaatcca 213 58 + +
R: ctcacagaggttggctcaca

SST mRNA was detected by RT-PCR in control but not in Sst−/− mouse islet extracts, confirming the absence of endogenous δ-cell SST in Sst−/− mice. SSTR1–5 mRNAs were identified in both control and Sst−/− islet extracts. F, forward primer, R, reverse primer.