TABLE 1.
Primers and conditions for semi-quantitative PCR analysis. Nucleotide sequences are reported for primer pairs used in RT-PCR analysis experiments in HepG2 and Caco-2 cells.
| Target Transcript | Primer Set | Annealing Temperature | Amplicon Size | No. of Cycles on HepG2 cDNA | No. of Cycles on Caco-2 cDNA |
|---|---|---|---|---|---|
| °C | bp | ||||
| FXR | F: ggaaccatactcgcaatacagc | 56 | 402 | 31 | 32 |
| R: tcgcatgtacatatccatcacac | |||||
| PXR | F: caagccaagtgttcacagtgag | 60 | 818 | 35 | 35 |
| R: caaagagcacagatcttccg | |||||
| UGT2B7 | F: agttggagaatttcatcatgcaacaga | 58 | 232 | 26 | 30 |
| R: tcagcccagcagctcaccacaggg | |||||
| I-BABP | F: gacttaggggctgagcctcagca | 60 | 491 | 34 | |
| R: ttgctcacgcgctcataggtcac | |||||
| GAPDH | F: acccactcctccacctttg | 64 | 178 | 25 | 25 |
| R: ctcttgtgctcttgctggg |
F, forward primer 5′-3′; R, reverse primer 5′-3′.