TABLE 2.
Oligonucleotide primers used for gene disruption and screening of C. albicans PHO100
| Primer | Target | Oligonucleotide sequence (5′→3′)a |
|---|---|---|
| DMORF_1 | Reintegrant cassette amplification | ATTAAGGAATCGGCTGCC |
| DMORF_2 | Reintegrant cassette amplification | CATGTCGTCTATCAGTCATCC |
| DMPHO100_1 | Amplification of 5′ region (contains a SacI site) | GACTGAGAGCTCGCAATGAGATTTGTTTAC |
| DMPHO100_2 | Amplification of 5′ region | GAGGCTGGAGTACCGTTG |
| DMPHO100_3 | Amplification of 3′ region (contains a SalI site) | AGCCTTGTCGACGGTCTCGGTGTTGGTTTG |
| DMPHO100_4 | Amplification of 3′ region (contains a SphI site) | CTGAAGGCATGCGTGACGATAAAGGAAGCG |
| DMPHO100_5 | Screening for gene disruption | TGACCAGTCAATCTAGTG |
a
Restriction sites in primer sequences are underlined.