Skip to main content
NCBI home page
NIHPA Author Manuscripts logoLink to NIHPA Author Manuscripts
. Author manuscript; available in PMC: 2009 Mar 18.
Published in final edited form as: J Immunol. 2009 Jan 15;182(2):751–758. doi: 10.4049/jimmunol.182.2.751

Pre-TCR-Induced β-Catenin Facilitates Traversal through β-Selection1

Mai Xu *, Archna Sharma *, David L Wiest †, Jyoti Misra Sen *,2
PMCID: PMC2657338  NIHMSID: NIHMS86981  PMID: 19124717

Abstract

Pre-TCR induced signals regulate development of the αβ TCR lineage cells at the β-selection checkpoint. We have previously shown that conditional deletion of β-catenin, a central mediator of Wnt-β-catenin-T cell factor signaling pathway, impairs traversal through the β-selection checkpoint. We now provide a molecular basis for the impairment. We demonstrate that pre-TCR signals specifically stabilize β-catenin in CD4−CD8− double negative thymocytes during β-selection. Pre-TCR induced Erk activity was required to stabilize β-catenin. Enforced expression of stabilized β-catenin was sufficient to mediate aspects of β-selection including sustained expression of early growth response (Egr) genes. Consistently, deletion of β-catenin reduced induction of Egr gene expression by the pre-TCR signal and blocked efficient β-selection. Thus, we demonstrate that pre-TCR induced β-catenin sustains expression of Egr genes that facilitate traversal through the β-selection checkpoint.

Bone marrow-derived precursor cells that commit to the αβ T lineage express a pre-TCR composed of a nonre-arranging pre-Tα protein and the rearranged TCRβ-chain (1–3). Signaling through the pre-TCR elicits multiple cellular responses that include cell survival, proliferation, down-regulation of pre-Tα and CD25 expression, up-regulation of sterile TCRα transcript, and initiation of rearrangement at the TCRα locus (4–7). Pre-TCR induced proliferation ensures the expansion of CD4−CD8− double negative (DN)3 clones expressing competent TCRβ-chain before maturation to the CD4+CD8+ double positive (DP) stage of development (8). At the DP stage rearrangement of TCRα-chain requires re-expression of RAG2 protein, which is only expressed in growth arrested cells (9, 10). TCRα-chain rearrangement and expression leads to the expression of αβTCR. DP thymocytes expressing αβTCR are subject to positive and negative selection to ensure self-restriction and avoid autoimmunity (11–15).

Pre-TCR signals target several nuclear factors including E proteins, NF-κB, NFAT, T cell factor (TCF)-1, and the early growth response (Egr) proteins (16–21). Egr proteins have been shown to be effectors of pre-TCR signals (19, 22). Egr1, 2, and 3 are all expressed during thymocyte development and induced in response to pre-TCR signaling. Over-expression of Egr proteins in pre-TCR signaling deficient thymocytes facilitates transition through the β-selection checkpoint while expression of dominant negative Egr proteins inhibits transition of DN3 thymocytes to the DN4 or pre-DP stage. Moreover, Egr3 deficient mice show a partial block at the DN3 stage of development (19, 22, 23). Thus, Egr proteins are targets of pre-TCR signaling and regulate several essential aspects of β-selection checkpoint.

β-catenin is a central mediator of Wnt-β-catenin-TCF signaling pathway. In the absence of Wnt-ligand binding to Frizzled receptor, GSK-3β phosphorylates β-catenin targeting it to the ubiquitin-dependent degradation pathway (24). Wnt signals block GSK-3β activity thereby stabilizing β-catenin, which then translocates to the nucleus and interacts with TCF and lymphocyte enhancer binding factor (LEF) to promote gene transcription (25–28). This signaling pathway has been implicated in T cell development by several studies. LEF and TCF double deficiency leads to a block in thymocyte development at the DN3 stage, in addition to a complete block at the immature single positive stage (29–31). Accordingly, we have reported that T cell-specific deletion of β-catenin impairs β-selection (32). Interestingly, over-expression of β-catenin facilitates the maturation of DN thymocytes to the DP stage, without the expression of pre-TCR or the TCR β-chain, suggesting that β-catenin over-expression substitutes for β-selection signals (33). Thus, the phenotype of thymocytes over-expressing β-catenin complements the observations noted in T cell specific deletion of β-catenin (32). These data suggest that β-catenin stabilization is necessary and sufficient for the transition of DN thymocytes to the DP stage. Accordingly, Wnt1 and Wnt4 deficiency (34), or blocking Wnt signaling by expression of extracellular inhibitors, modified Frizzled receptors (35) or Dickkopf (36) or intracellular inhibitors Axin (37) or ICAT (38) all impaired early stages of thymocyte development, indicating the importance of Wnt-β-catenin-TCF signaling. Despite these data, the role of β-catenin in lymphocytes remains controversial in large measure due to three reports that showed that deletion of β-catenin in HSCs did not impair hematopoiesis or lymphopoiesis (39–41), even though Jeannet et al. demonstrated that TCF-reporter activity was measurable in all HSC-derived cells suggesting that signaling from this pathway remained intact in their studies (41). In summary, whereas a substantial body of work suggests β-catenin plays an important role in lymphocyte development contradictions presented by more recent work warrant clarification.

In this report, we demonstrate that pre-TCR signals transiently stabilize β-catenin in DN thymocytes and facilitate transition through β-selection. Pre-TCR signaling induces stabilization of β-catenin by an Erk-dependent pathway. Enforced expression of stabilized β-catenin was sufficient to mediate down-regulation of cell surface CD25 expression, pre-Tα expression and induce expression of Egr genes and sterile TCRα transcript. Using mice that express a stabilized β-catenin transgene (CAT-Tg), and mice that are deficient for β-catenin (CAT-KO), we demonstrate that pre-TCR induced β-catenin regulates the expression of Egr genes that critically control transition of DN cells to the DP stage of development. Finally, we demonstrate that β-catenin is bound to the regulatory region of Egr genes and directly regulates their expression.

Materials and Methods

Mouse strains

CAT-Tg mice and CAT-KO mice, generated by crossing mice bearing loxed β-catenin gene (The Jackson Laboratory) (42) with Lck-Cre mice (43) all on C57BL/6 genetic background were described previously (44, 45). RAG2-deficient mice and BAT-lacZ mice (46) were purchased from The Jackson Laboratory. Egr3 transgenic mice were generated using the VA-hCD2 vector, which directs transgene expression in T cells beginning with DN2/3 stage thymocytes (47, 48). An Egr3 cDNA encompassing the translational start and stop codons was generated by PCR, sequence verified, subcloned into VA-hCD2 using standard methodology, and injected by the Fox Chase Transgenic Mouse Facility. Founders were bred to RAG2−/− mice. Where not specified, age-matched 6–12-wk-old mice were used. All animal procedures were in compliance with the guidelines of NIA animal resources facility, which operates under the regulatory requirements of the U.S. Department of Agriculture and Association for Assessment and Accreditation of Laboratory Animal Care.

Cell lines and in vitro cell culture

Scid.adh cells have been described (4). Scid.adh.Te3 cells are Scid.adh cells transfected with TAC:CD3ε chimera, which can be stimulated by anti-TAC Ab, to mimic pre-TCR signaling (4). In brief, 0.5–1 × 106 Scid.adh.Te3 cells were stimulated by plate-bound anti-TAC Ab (10 µg/ml) at 37°C in 1 ml RPMI 1640 in 24-well tissue culture plates.

Flow cytometry and Abs

Four-color flow cytometry was done using FACScalibur (BD Pharmingen) following staining with combination of anti-CD3, -CD4, -CD8, -c-kit, -CD44, -CD25, -CD5, -IL-7R Abs conjugated to FITC, PE, PercpCy5.5, allophycocyanin (BD Pharmingen). Lineage mixture contained Abs to CD4, CD8, TCRβ, TCRγδ, B220, NK1.1, Gr1, and Mac-1. For cell sorting, cell suspensions of thymocytes were stained with biotinylated anti-CD4 and anti-CD8 Abs, followed by incubation with anti-biotin microbeads (Miltenyi Biotec) and magnetic depletion of DP and single positive cells. Enriched cell suspensions were surface-stained with anti-CD25, anti-c-kit and lineage Ab mixture followed by sorting using MoFlo.

Quantitative and semiquantitative PCR

mRNA from sorted cells was extracted with RNeasyMicro Kit (Qiagen). cDNA was prepared with Superscript II RT kit (Invitrogen). SYBR green quantitative RT-PCR was performed using PCR Master Mix from A&B Applied Biosystem following the manufacturer’s instructions. The expression of target gene was determined relative to GAPDH and calculated as 2−(CtTarget gene − CtGAPDH). All the primer sequences are available upon request.

Western blot analysis

Immunoblotting was performed with whole-cell lysates or nuclear extracts resolved on 4–12% Bis-Tris SDS-PAGE, transferred to nitrocellulose membrane and detected using Abs against mouse β-catenin (BD Transduction Laboratory), anti-active-β-catenin (anti-ABC, clone 8E7) (Upstate Biotechnology), mouse β-actin (Sigma-Aldrich), and nucleoporin p62 (BD Transduction Laboratory).

Chromatin immunoprecipitation (ChIP) assays

ChIP procedure was performed with nuclear extracts from 12 h anti-TAC treated and untreated 5–10 × 106 Scid.adh.Te3 cells fixed with 1% formaldehyde. Sonicated nuclear lysates were immunoprecipitaed with either anti-β-catenin Ab or rabbit IgG (Santa Cruz Biotechnology). After purification of DNA coprecipitated with Abs DNA encompassing putative TCF binding sites in Egr1, Egr2, and Egr3 genes was amplified using specific primers by quantitative real-time PCR. An irrelevant region 5-kb downstream of Egr1, Egr2, and Egr3 transcription start site was amplified as a control. All primers are available upon request.

EMSAs

EMSAs were conducted with 2 ng of 32P-labeled oligonucleotide DNA probes (40–50000 c.p.m.) in a final reaction volume of 15 µl containing 10 mM Tris-HCl (pH 7.5), 50 ng poly (dI-dC), 50 mM NaCl, 10 mM 2-ME, 1 mM EDTA, and 4% glycerol for 30 min at 4°C. Reactions were resolved on a 6% polyacrylamide gel. A partially purified LEF1 protein preparation was used (generous gift from Dr. Marian Waterman, University of California, Irvine, CA). The positive control oligos encode a consensus Wnt response element (49). The putative TCF/LEF binding sites identified in Egr1, 2, and 3 genes are listed: Egr1 sense: 5′gaatcccttctccctttgggttgctt 3′, anti-sense: 5′gaagcaacccaaagggagaagggatt 3′; Egr2 sense: 5′gaactgggaggcccctttgaccagatgaa 3′, anti-sense: 5′gttcatctggtcaaaggggcctcccagtt 3′; Egr3 sense: 5′gaaccccttccccaaaggaaaatactt 3′, anti-sense: 5′gaagtattttcctttggggaaggggtt 3′.

Retroviral infection

Scid.adh cells were infected with murine stem cell virus-based retroviruses that coexpress human CD8 and stabilized mouse β-catenin. Human CD8 positive cells were sorted for analysis.

Results

Pre-TCR induces stabilization and nuclear localization of β-catenin via ERK activation

To test whether β-catenin is a target of pre-TCR signaling, we used a well-established model in which anti-CD3 Ab injection mediates differentiation of RAG2-deficient DN3 thymocytes to the DN4/pre-DP stage of development (50). In a time course study, at 18 h after anti-CD3 Ab injection, 60–70% thymocytes were still at the DN3 stage while 30–40% had differentiated to the DN4 stage (Fig. 1A). Egr genes are early indicators of pre-TCR signal and induction of their expression by 12-h post anti-CD3 Ab injection suggested that DN cells had received a pre-TCR-like signal (Fig. 1A). Under these conditions a 2.5-fold increase in stabilized β-catenin was documented in four independent Western blot experiments (Fig. 1A). These data show that the level of pre-TCR induced stabilization of β-catenin is comparable to 2-fold β-catenin accumulation in stimulated macrophages, B cells, and T cells (32, 51, 52). Thus, these data demonstrate that the anti-CD3 Ab dependent pre-TCR signal, which induces the development of RAG2-deficient DN3 thymocytes to the DN4 stage in vivo, stabilizes β-catenin protein levels and suggest that β-catenin may be a direct target of pre-TCR signals.

FIGURE 1. Pre-TCR signals induce β-catenin stabilization and nuclear localization by an Erk-dependent pathway.

FIGURE 1

Open in a new tab

A, Injection of anti-CD3 Ab into RAG2−/− mice induces development of DN3 (CD25+CD44−) thymocytes to the DN4 (CD25−CD44−) stage, induces Egr gene expression and stabilizes β-catenin. Total thymocytes from anti-CD3 injected or uninjected RAG2-deficient mice were assayed for the abundance of Egr mRNA at 12 h and for β-catenin protein levels at the indicated times after injection. Anti-CD3 Ab activated RAG2-deficient ex vivo thymocytes were also assayed for total and dephosphorylated β-catenin protein at different times post injection (bottom left panel) (average of four independent experiments). B, Pre-TCR signals activate TCF-reporter activity. DN thymocytes from BAT-lacZ and C57BL/6 mice were stimulated with plate-bound anti-CD3 Ab for 6 and 24 h and the abundance of β-galactosidase mRNA was assayed (average of five mice of each genotype in a representative experiment). Fold increase in the abundance of β-galactosidase in BAT-LacZ thymocytes over C57BL/6 thymocytes is shown. C, Pre-TCR induced ERK activity is essential for β-catenin stabilization and nuclear localization. Cross-linking hCD25-CD3ε chimeric protein on Scid.Tε3 cells using anti-TAC Ab induces pre-TCR like signals and causes down-regulation of surface CD25 expression which is blocked by MEK inhibitor (representative of four independent experiments). Scid.Tε3 cells were stimulated with plate bound anti-TAC Ab with and without MEK inhibitor PD98059 (PD). D, Anti-TAC Ab cross-linking of hCD25-CD3ε chimeric protein on Scid.Tε3 cells induces stabilization and nuclear localization of β-catenin, which is blocked by MEK inhibitor. Nuclear extracts from Scid.Tε3 cells stimulated with anti-TAC Ab in the presence and absence of PD98059 were analyzed by Western blot. The graphs provide densitometric analysis of the Western blots (average of three independent experiments).

To demonstrate that pre-TCR signals induced β-catenin-TCF signaling, we used BAT-lacZ transgenic mice that express the lacZ gene under the control of a regulatory sequence consisting of seven consensus LEF/TCF-binding motifs upstream of the Xenopus siamois gene minimal promoter (46). Thus, β-galactosidase expression reports TCF activity in vivo. Purified DN thymocytes from BAT-lacZ or control mice were stimulated with plate-bound anti-CD3 Ab for indicated times to induce pre-TCR signaling and mRNA extracted from them were analyzed by real-time PCR for β-galactosidase expression. After 6 and 24 h of anti-CD3 stimulation, BAT-lacZ DN cells up-regulated β-galactosidase expression relative to the control mice DN cells and to unstimulated BAT-lacZ DN cells (Fig. 1B). These data suggest that β-catenin/TCF activity was induced by pre-TCR signaling.

Ab-mediated cross-linking of CD3ε-chain on RAG2-deficient thymocytes regulates β-catenin stabilization and transition of the DN3 cells to the DN4/pre-DP stage demonstrating that pre-TCR signals induce β-catenin expression. To test whether pre-TCR signals directly induce β-catenin stabilization we used the Scid.adh cell line in vitro. The Scid.adh.Te3 cell line lacks endogenous TCRβ-chain expression but expresses transfected human CD25 (hCD25)-CD3ε chimeric protein. Cross-linking of hCD25-CD3ε on the surface of Scid.adh.Te3 cell line with anti-TAC Ab has been shown to mimic several molecular aspects of β-selection (4, 19). As has been previously documented, cross-linking cell surface hCD25-CD3ε with anti-TAC Ab induced pre-TCR like signals that extinguished the expression of murine CD25 and partially up-regulated expression of CD5 (Fig. 1C). Under these conditions, β-catenin accumulation in the nucleus of signaled cells was documented by Western blots using nuclear extracts (Fig. 1D, left). An ~2-fold increase in the amount of β-catenin protein accumulation was noted in three independent experiments. Pre-TCR signaling induced activation of ERK is essential for CD25 down-regulation (53). To determine whether ERK may be an intermediate between the pre-TCR signal and β-catenin stabilization we used PD98059, an inhibitor of ERK activation. Inclusion of PD98059 in the cultures during anti-TAC cross-linking blocked the down-regulation of CD25 and accumulation of β-catenin in the nucleus demonstrating that TAC-induced nuclear β-catenin accumulation was ERK dependent (Fig. 1D). These data demonstrate that in Scid.adh cells pre-TCR signals, via the activation of ERK signaling, directly induce the stabilization and nuclear localization of β-catenin.

β-catenin expression is sufficient to regulate Egr expression during β-selection

Several molecular events that accompany β-selection in vivo are mimicked in the Scid.adh.Te3 cell line by cross-linking of the hCD25-CD3ε chimeric protein using anti-TAC Ab (this report and Ref. 4, 19). To determine which of the events were regulated by β-catenin stabilization we expressed stabilized β-catenin gene in Scid.adh cells using a retroviral vector. In a population of Scid.adh cells with >70% infection efficiency (data not shown), we noted dramatic down-regulation of CD25 and up-regulation of IL-7Rα-chain (Fig. 2A). To assess molecular changes enforced by β-catenin expression retrovirally infected cells were sorted and RNA was prepared. At a molecular level pre-Tα gene expression was significantly diminished whereas expression of sterile TCRα transcript, Egr1 and Egr2 genes were increased (Fig. 2B). High expression of Egr3 in Scid.adh cells precluded analysis of its induction by β-catenin (data not shown). These observations indicate that expression of β-catenin in the Scid.adh cells reproduces the effects of cross-linking the hCD25-CD3ε chimera (4, 19). Together these data demonstrate that enforced expression of stabilized β-catenin in Scid.adh cells mimicked events that normally accompany pre-TCR signals. We conclude that stabilized β-catenin was sufficient to partially induce traversal through the β-selection checkpoint.

FIGURE 2. Enforced expression of β-catenin is sufficient to mediate aspects of β-selection.

FIGURE 2

Open in a new tab

A, Enforced expression of β-catenin in Scid.adh cells induces aspects of pre-TCR signal. Scid.adh cells transduced with retroviral stabilized β-catenin (line histogram) or vector alone (shaded histogram) were stained with anti-CD25, -IL-7R, and -CD5 Abs and analyzed by flow cytometry. Cell size was also documented. B, Expression of stabilized β-catenin mimics molecular aspects of pre-TCR signals. The abundance of pre-Tα, sterile TCRα transcript, Egr1, and Egr2 mRNA was assayed relative to GAPDH in vector or stabilized β-catenin transduced cells (average of three independent experiments).

β-catenin expression regulates Egr gene expression in vivo

We have previously reported that tissue-specific deletion of β-catenin in DN3 cells impairs β-selection (32). In CAT-KO mice the gene is deleted partially in DN3 cells and more dramatically in DN4 cells (Fig. 3A). The Lck promoter activity has been documented in DN2 cells, however for reasons not yet understood, Lck-Cre was not active in CAT-KO DN2 cells (data not shown). To determine the effect of β-catenin deletion on Egr gene expression, mRNA from sorted CAT-KO DN3 and DN4 cells was analyzed. The abundance of mRNA for Egr family genes was comparable in CAT-KO and control mice DN3 cells (Fig. 3B), this is because deletion of β-catenin is partial in CAT-KO DN3 thymocytes. Pre-TCR signaling induced the expression of Egr1 and Egr3 genes and to a lesser extent Egr2 gene (Fig. 3B). However, expression of all three Egr genes was decreased in CAT-KO DN4 cells (Fig. 3B). Expression of Egr genes was not completely abrogated in CAT-KO DN4 cells indicating that additional factors regulate these genes. Egr 2 and 3 genes showed the greatest decrease in CAT-KO DN4 cells. These data demonstrate that pre-TCR induced β-catenin was necessary for efficient expression of Egr genes in DN4 thymocytes during T cell development.

FIGURE 3. β-Catenin expression regulates expression of Egr genes in vivo.

FIGURE 3

Open in a new tab

Decreased expression of Egr genes in ex vivo CAT-KO DN4 cells. A, T cell-specific deletion of β-catenin gene in CAT-KO mice reduces β-catenin expression in a graded manner in DN3 and DN4 cells. The abundance of β-catenin mRNA in sorted DN3 and DN4 thymocytes from C57BL/6 mice and CAT-KO mice was analyzed by real time PCR. B, Loss of β-catenin expression in DN4 CAT-KO thymocytes leads to reduced expression of Egr genes. The abundance of Egr mRNA in sorted DN3 and DN4 thymocytes from CAT-KO and C57BL/6 was analyzed by real time PCR. Data are average of three mice of each genotype in a representative experiment. Increased expression of Egr genes in CAT-Tg DN4 thymocytes. C, Expression of human β-catenin gene in CAT-Tg thymocytes increases β-catenin expression in a graded manner in DN3 and DN4 cells. The abundance of human β-catenin mRNA in sorted DN3 and DN4 thymocytes from C57BL/6 mice and CAT-Tg mice was assayed by real time PCR. D, Increased expression of β-catenin in DN4 CAT-Tg thymocytes results in increased expression of Egr genes. mRNA from sorted CAT-Tg and control DN3 and DN4 thymocytes was analyzed by real time PCR for the abundance of Egr mRNA. Data are average of three mice of each genotype in a representative experiment.

CAT-Tg mice express stabilized human β-catenin gene from the proximal Lck promoter (44). The mRNA for the transgene was not expressed in DN2 cells (54), expressed at low levels in sorted DN3 cells, and expressed at high levels in DN4 cells (Fig. 3C). Increase in β-catenin mRNA level led to increased expression of the protein in DN4 cells (data not shown). Expression of Egr genes was comparable in control and CAT-Tg DN3 cells but increased in CAT-Tg DN4 cells compared with control DN4 cells (Fig. 3D). These data demonstrate that expression of transgenic β-catenin in DN4 cells was sufficient to induce expression of Egr genes. Together these data suggest that pre-TCR induced β-catenin regulates expression of Egr genes during β-selection in vivo.

Enforced expression of Egr3 facilitates traversal through β-selection

To determine whether Egr expression down-stream of pre-TCR was sufficient to regulate β-selection, we used RAG2KO-Egr3-Tg mice. Enforced expression of Egr3 transgene, from the CD2 promoter, promoted the development of RAG2-deficient DN3 thymocytes to the DN4 stage and subsequently to the DP stage of development (Fig. 4). These data demonstrate that Egr3 expression was sufficient to facilitate β-selection in RAG2-deficient DN3 cells. We conclude that pre-TCR induced β-catenin results in increased Egr gene expression which facilitates β-selection.

FIGURE 4. Enforced expression of Egr3 expression is sufficient to induce β-selection in RAG2-deficient thymocytes in vivo.

FIGURE 4

Open in a new tab

A, Transgenic expression of Egr3 promotes maturation of RAG2-deficient DN3 thymocytes to DN4 and then DP thymocytes. The graphs represent absolute numbers of total, DN4, and DP thymocytes from RAG2KO and RAG2KO-Egr3-Tg mice (average of three mice of each genotype in a representative experiment). B and C, Representative dot plots of thymocytes stained with anti- CD44 and anti-CD25 or anti-CD4 and anti-CD8 Abs and analyzed by flow cytometry are shown. The strains of mice are listed above each dot plot. Because transition to DP stage is variable in different mice, analysis of two RAG2KO-Egr3-Tg mice is shown.

β-catenin associates with the TCF binding sites in Egr promoter region

β-catenin regulates gene expression in conjunction with TCF which contacts DNA directly. Transcription factors of the TCF family bind DNA via the 80 amino acid HMG box to a consensus sequence AACAAAG through contacts made predominantly within the minor groove of the DNA helix (55, 56). To test whether β-catenin, in cooperation with TCF, directly regulated Egr expression, we searched mouse Egr1, 2, 3 genes for the core consensus sequence (CAAAGG) of TCF binding sites. All three Egr genes contained matches to consensus TCF/LEF binding sites that were conserved in human and murine Egr genes (Fig. 5A). Thus, all three Egr genes have conserved sequences containing potential TCF/LEF binding sites.

FIGURE 5. β-Catenin binds to TCF binding sites in the Egr1, Egr2, and Egr3 genes.

FIGURE 5

Open in a new tab

A, Egr1 and Egr3 contain TCF binding sites (represented as closed rectangles) in the region up-stream of the transcription start site and Egr2 gene in the intronic region (top panel). DNA sequences from sites five or more kilobases downstream (data not shown) were identified to be used as controls. Alignment of Egr1, 2, and 3 DNA sequences show nucleotide conservation between human and mouse genes in the regions of interest (bottom panel). B, β-catenin binds to TCF binding sites in vitro. EMSA with partially purified LEF1 protein shows LEF1 binding to TCF/LEF binding sites in Egr1, Egr2, and Egr3 genes. C, Anti-TAC Ab stimulation of Scidh.adh.Te3 cells induce pre-TCR like signals and causes up-regulation of Egr gene expression. Scid.adh.Te3 cells were stimulated with plate-bound anti-TAC Ab and RNA extracted from un-stimulated and stimulated cells was analyzed for expression of Egr mRNA relative to GAPDH. D, β-catenin binds to TCF binding sites in vivo. ChIP assays show that β-catenin associates with TCF binding sites in Egr1, Egr2, and Egr3 genes in response to pre-TCR signal. Graphs represent quantitative PCR presented as a mean of the ratios of the amount of immunoprecipitated (IP) DNA in each sample relative to input DNA (diluted). IP with anti-β-catenin Ab from anti-TAC stimulated Scid.adh.Te3 cells is compared to IP with nonspecific IgG from stimulated and to IP with anti-β-catenin Ab from un-stimulated cells (average of four independent experiments).

To determine whether TCF binding sites in Egr genes could bind TCF/LEF family proteins we did EMSAs with purified LEF protein and oligonucleotides containing the TCF/LEF binding sites from the Egr genes. LEF protein formed a DNA protein complex with labeled oligonucleotides corresponding to TCF binding sites from all three Egr genes (Fig. 5B). These results demonstrate that TCF/LEF binding sites in the regulatory regions of Egr1, Egr2, and Egr3 genes are capable of binding TCF/LEF family proteins.

Specific primers for ChIP assays containing TCF/LEF binding sites in Egr1, Egr2, and Egr3 genes and nonspecific primers corresponding to a DNA sequence several kilo-bases downstream (Egr-downstream) were designed. Scid.adh.Te3 cells were stimulated with anti-TAC Ab for 12 h and analyzed for expression of Egr mRNA. Anti-TAC Ab stimulation did induce transcription of Egr genes (Fig. 5C) as also previously shown (4). To determine whether β-catenin bound to the Egr regulatory region we compared unstimulated and anti-TAC-stimulated cells by ChIP analysis (Fig. 5D). We used DNA templates that were not subjected to immunoprecipitation (input) as normalizing control. PCR was then performed using the DNA coimmunoprecipitated by anti- β-catenin Ab or control rabbit IgG Ab (Fig. 5D). Control nonspecific primers from a site 5 kb downstream from the transcription start site did not show any enrichment of specific DNA sequences in the anti-β-catenin Ab precipitates (data not shown). In contrast, immunoprecipitates with anti-β-catenin Ab were enriched for sequences containing TCF binding sites in all three Egr genes in stimulation conditions compared with resting cells or to immunoprecipitates with control rabbit IgG Ab (Fig. 5D). These data demonstrate that β-catenin was bound to DNA sequences that had the TCF/LEF binding sites in Egr genes. We conclude that TCF/LEF-β-catenin complexes bound to regulatory elements in Egr gene loci and directly regulated expression of Egr genes upon pre-TCR signaling.

Discussion

The role for Wnt-β-catenin-TCF pathway in T cell development remains highly controversial despite the demonstration that Wnt1 and Wnt4 deficiency (34), β-catenin deficiency (32) and TCF and LEF deficiencies (29, 30) impair T cell development. This is largely due to a lack of a lymphoid phenotype in mice with Mx1-cre dependent deletion of β-catenin (recently reviewed in Ref. 57). Although we are unable to solve the entire mystery of lack of phenotype in Mx1-cre deleted mice we provide molecular evidence to support a role for β-catenin at the β-selection checkpoint. We have previously shown that T cell specific deletion of β-catenin impairs β-selection (32). In this report, we provide molecular data that reinforces the importance of this pathway during β-selection. We demonstrate that pre-TCR induced β-catenin directly regulates the expression of Egr genes which are necessary and sufficient for traversal through β-selection.

We have reported that even partial deletion of β-catenin in DN3 cells results in a partial block in development at the DN3 stage (32). Conversely, enforced expression of β-catenin, correlates with an increased proportion of post-β-selection cells (data not shown). These data raise the possibility that the pre-TCR may regulate β-catenin stabilization. In this report, using a well defined in vivo model, we demonstrate that pre-TCR signals stabilize and induce nuclear localization of β-catenin. Injection of anti-CD3 Ab in RAG2-deficient mice induced the differentiation of DN3 cells to the DN4 stage and induced Egr gene expression indicating traversal through β-selection. After 18 h of exposure to anti-CD3 Ab DN3 cells showed 2.5-fold increase in stabilized β-catenin in the nucleus. Previous data had indicated that whereas β-catenin was expressed in RAG1-deficient DN thymocytes, no increase was documented upon anti-CD3 injection (17). We also note no difference in the amount of stabilized β-catenin when we assay total cell lysates. In contrast, analysis of nuclear β-catenin shows a clearly measurable increase. Because ex vivo DN3 thymocytes express higher levels of β-catenin compared with DN4 thymocytes, these data suggest that pre-TCR signaled DN3 cells induce β-catenin stabilization before transition to the DN4 stage.

Pre-TCR signaling induced Erk activity was essential for β-catenin stabilization. We suggest that Erk mediated phosphorylation of GSK-3β at ser9 blocked phosphorylation and degradation of β-catenin (58), allowing its accumulation during β-selection. These data suggest regulation of β-catenin by pre-TCR signaling. In support of this notion, we demonstrate that anti-CD3 Ab mediated stimulation of BAT-lacZ reporter expressing DN thymocytes induced pre-TCR driven TCF activity. These observations are not congruent with the earlier observation that TCR-like signals stabilize β-catenin but do not induce TCF reporter activity in Jurkat cells (59). We suggest that this is due to high levels of endogenous β-catenin expression in Jurkat cells making further up-regulation of TCF-reporter activity difficult to demonstrate. A role for Wnt1 and Wnt4 in DN thymocytes has been previously demonstrated (34), suggesting the possibility that pre-TCR signals induce Wnt signaling, which then stabilizes β-catenin. Increased expression of target genes Id2 (data not shown) and p16 (54) also suggests enhanced β-catenin activity in DN thymocytes. Enforced expression of stabilized β-catenin induced several aspects of β-selection including down-regulation of CD25 and pre-Tα, and up-regulation of sterile TCRα transcript and Egr genes. These data indicate that β-catenin expression was sufficient to mediate essential aspects of β-selection. Therefore, we propose that pre-TCR induced β-catenin is required and sufficient to mediate some aspects of β-selection.

Egr proteins regulate β-selection (19, 22). In particular, Egr3-deficient mice show a partial block at the DN3 stage of development (23). In this report, we show that pre-TCR induced β-catenin regulates expression of Egr genes during β-selection. Retroviral expression of stabilized β-catenin was sufficient to induce Egr1 and 2 expression in Scid.adh cells. Accordingly, DN4 thymocytes from CAT-Tg mice showed increased expression of Egr genes whereas ex vivo CAT-KO DN4 thymocytes showed decreased expression of all three Egr genes. These data demonstrate that β-catenin expression regulated Egr gene expression in vivo. The finding that Egr genes contained consensus TCF binding sites that were conserved between human and mouse genes raised the possibility that β-catenin may directly regulate their transcription. Indeed, direct binding of β-catenin to the TCF binding sites was documented using ChIP and EMSA assays. TCF-reporter activity has been previously reported in DN3 thymocytes (17) raising the possibility that β-catenin and TCF/LEF may cooperatively regulate Egr expression. We propose that pre-TCR induced β-catenin cooperates with TCF to regulate Egr expression and facilitates β-selection. Finally, we tested whether Egr expression was sufficient to mediate traversal through β-selection by breeding Egr3-Tg mice with RAG2-deficient mice. Indeed, Egr3 expression was sufficient to efficiently regulate β-selection and facilitate the transition of DN3 cells to the DN4 stage. Therefore, we propose that pre-TCR induced β-catenin in cooperation with TCF regulate Egr gene expression and facilitates β-selection in vivo. In summary, data provided in this article demonstrate that pre-TCR induced β-catenin stabilization and nuclear localization regulates expression of Egr genes and thereby facilitates traversal through the β-selection checkpoint.

Acknowledgments

We thank Noriko Yokoyama, Beibei Wu, and Dr. Marian Waterman for LEF/TCF protein and DNA binding reagents; Dr. Hansen Du of Dr. Ranjan Sen’s laboratory for help with EMSAs; Tiffany Simms for technical assistance; Dr. Qing Yu for helpful suggestions throughout this work and on the manuscript; Dr. Robert Wersto, Francis J. Chrest and Cuong Nguyen for expert cell sorting; Crystal Gifford and Dawn Nines for maintaining animals; and Dr. Shengyuan Luo and his team for genotyping.

Footnotes

1

This research was supported by the Intramural Research Program of the National Institute on Aging at the National Institutes of Health.

3

Abbreviations used in this paper: DN, double negative; DP, double positive; TCF, T cell factor; Egr, early growth response; CAT-Tg, β-catenin transgene; ChIP, chromatin immunoprecipitation; hCD25, human CD25; LEF, lymphocyte enhancer binding factor.

Disclosures

The authors have no financial conflict of interest.

References

  • 1.Aifantis I, Mandal M, Sawai K, Ferrando A, Vilimas T. Regulation of T-cell progenitor survival and cell-cycle entry by the pre-T-cell receptor. Immunol. Rev. 2006;209:159–169. doi: 10.1111/j.0105-2896.2006.00343.x. [DOI] [PubMed] [Google Scholar]
  • 2.Ciofani M, Zuniga-Pflucker JC. A survival guide to early T cell development. Immunol. Res. 2006;34:117–132. doi: 10.1385/IR:34:2:117. [DOI] [PubMed] [Google Scholar]
  • 3.von Boehmer H. Unique features of the pre-T-cell receptor α-chain: not just a surrogate. Nat. Rev. Immunol. 2005;5:571–577. doi: 10.1038/nri1636. [DOI] [PubMed] [Google Scholar]
  • 4.Carleton M, Ruetsch NR, Berger MA, Rhodes M, Kaptik S, Wiest DL. Signals transduced by CD3ε, but not by surface pre-TCR complexes, are able to induce maturation of an early thymic lymphoma in vitro. J. Immunol. 1999;163:2576–2585. [PubMed] [Google Scholar]
  • 5.Hozumi K, Tanaka Y, Sato T, Wilson A, Habu S. Evidence of stage-specific element for germ-line transcription of the TCR α gene located upstream of Jα49 locus. Eur. J. Immunol. 1998;28:1368–1378. doi: 10.1002/(SICI)1521-4141(199804)28:04<1368::AID-IMMU1368>3.0.CO;2-B. [DOI] [PubMed] [Google Scholar]
  • 6.Koyasu S, Clayton LK, Lerner A, Heiken H, Parkes A, Reinherz EL. Pre-TCR signaling components trigger transcriptional activation of a rearranged TCR α gene locus and silencing of the pre-TCR α locus: implications for intrathymic differentiation. Int. Immunol. 1997;9:1475–1480. doi: 10.1093/intimm/9.10.1475. [DOI] [PubMed] [Google Scholar]
  • 7.Levelt CN, Wang B, Ehrfeld A, Terhorst C, Eichmann K. Regulation of T cell receptor (TCR)-β locus allelic exclusion and initiation of TCR-α locus rearrangement in immature thymocytes by signaling through the CD3 complex. Eur. J. Immunol. 1995;25:1257–1261. doi: 10.1002/eji.1830250519. [DOI] [PubMed] [Google Scholar]
  • 8.Hoffman ES, Passoni L, Crompton T, Leu TM, Schatz DG, Koff A, Owen MJ, Hayday AC. Productive T-cell receptor β-chain gene rearrangement: coincident regulation of cell cycle and clonality during development in vivo. Genes Dev. 1996;10:948–962. doi: 10.1101/gad.10.8.948. [DOI] [PubMed] [Google Scholar]
  • 9.Jiang H, Chang FC, Ross AE, Lee J, Nakayama K, Nakayama K, Desiderio S. Ubiquitylation of RAG-2 by Skp2-SCF links destruction of the VDJ recombinase to the cell cycle. Mol. Cell. 2005;18:699–709. doi: 10.1016/j.molcel.2005.05.011. [DOI] [PubMed] [Google Scholar]
  • 10.Jiang H, Ross AE, Desiderio S. Cell cycle-dependent accumulation in vivo of transposition-competent complexes between recombination signal ends and full-length RAG proteins. J. Biol. Chem. 2004;279:8478–8486. doi: 10.1074/jbc.M311219200. [DOI] [PubMed] [Google Scholar]
  • 11.Sprent J, Kishimoto H. The thymus and negative selection. Immunol. Rev. 2002;185:126–135. doi: 10.1034/j.1600-065x.2002.18512.x. [DOI] [PubMed] [Google Scholar]
  • 12.Janeway CA., Jr T-cell development: a role for self-peptides in positive selection. Curr. Biol. 1999;9:R342–R345. doi: 10.1016/s0960-9822(99)80209-7. [DOI] [PubMed] [Google Scholar]
  • 13.Saito T, Watanabe N. Positive and negative thymocyte selection. Crit. Rev. Immunol. 1998;18:359–370. doi: 10.1615/critrevimmunol.v18.i4.40. [DOI] [PubMed] [Google Scholar]
  • 14.Fowlkes BJ, Schweighoffer E. Positive selection of T cells. Curr. Opin. Immunol. 1995;7:188–195. doi: 10.1016/0952-7915(95)80003-4. [DOI] [PubMed] [Google Scholar]
  • 15.Jameson SC, Hogquist KA, Bevan MJ. Positive selection of thymocytes. Annu. Rev. Immunol. 1995;13:93–126. doi: 10.1146/annurev.iy.13.040195.000521. [DOI] [PubMed] [Google Scholar]
  • 16.Anderson MK. At the crossroads: diverse roles of early thymocyte transcriptional regulators. Immunol. Rev. 2006;209:191–211. doi: 10.1111/j.0105-2896.2006.00352.x. [DOI] [PubMed] [Google Scholar]
  • 17.Goux D, Coudert JD, Maurice D, Scarpellino L, Jeannet G, Piccolo S, Weston K, Huelsken J, Held W. Cooperating pre-T-cell receptor and TCF-1-dependent signals ensure thymocyte survival. Blood. 2005;106:1726–1733. doi: 10.1182/blood-2005-01-0337. [DOI] [PubMed] [Google Scholar]
  • 18.Engel I, Murre C. E2A proteins enforce a proliferation checkpoint in developing thymocytes. EMBO J. 2004;23:202–211. doi: 10.1038/sj.emboj.7600017. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19.Carleton M, Haks MC, Smeele SA, Jones A, Belkowski SM, Berger MA, Linsley P, Kruisbeek AM, Wiest DL. Early growth response transcription factors are required for development of CD4− CD8− thymocytes to the CD4+CD8+ stage. J. Immunol. 2002;168:1649–1658. doi: 10.4049/jimmunol.168.4.1649. [DOI] [PubMed] [Google Scholar]
  • 20.Aifantis I, Gounari F, Scorrano L, Borowski C, von Boehmer H. Constitutive pre-TCR signaling promotes differentiation through Ca2+ mobilization and activation of NF-κB and NFAT. Nat. Immunol. 2001;2:403–409. doi: 10.1038/87704. [DOI] [PubMed] [Google Scholar]
  • 21.Kruisbeek AM, Haks MC, Carleton M, Michie AM, Zuniga-Pflucker JC, Wiest DL. Branching out to gain control: how the pre-TCR is linked to multiple functions. Immunol. Today. 2000;21:637–644. doi: 10.1016/s0167-5699(00)01744-8. [DOI] [PubMed] [Google Scholar]
  • 22.Xi H, Kersh GJ. Early growth response gene 3 regulates thymocyte proliferation during the transition from CD4−CD8− to CD4+CD8+ J. Immunol. 2004;172:964–971. doi: 10.4049/jimmunol.172.2.964. [DOI] [PubMed] [Google Scholar]
  • 23.Carter JH, Lefebvre JM, Wiest DL, Tourtellotte WG. Redundant role for early growth response transcriptional regulators in thymocyte differentiation and survival. J. Immunol. 2007;178:6796–6805. doi: 10.4049/jimmunol.178.11.6796. [DOI] [PubMed] [Google Scholar]
  • 24.Aberle H, Bauer A, Stappert J, Kispert A, Kemler R. β-catenin is a target for the ubiquitin-proteasome pathway. EMBO J. 1997;16:3797–3804. doi: 10.1093/emboj/16.13.3797. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25.Behrens J, Jerchow BA, Wurtele M, Grimm J, Asbrand C, Wirtz R, Kuhl M, Wedlich D, Birchmeier W. Functional interaction of an axin homolog, conductin, with β-catenin, APC, and GSK3β. Science. 1998;280:596–599. doi: 10.1126/science.280.5363.596. [DOI] [PubMed] [Google Scholar]
  • 26.Ikeda S, Kishida S, Yamamoto H, Murai H, Koyama S, Kikuchi A. Axin, a negative regulator of the Wnt signaling pathway, forms a complex with GSK-3β and β-catenin and promotes GSK-3β-dependent phosphorylation of β-catenin. EMBO J. 1998;17:1371–1384. doi: 10.1093/emboj/17.5.1371. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27.Young CS, Kitamura M, Hardy S, Kitajewski J. Wnt-1 induces growth, cytosolic β-catenin, and Tcf/Lef transcriptional activation in Rat-1 fibroblasts. Mol. Cell. Biol. 1998;18:2474–2485. doi: 10.1128/mcb.18.5.2474. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28.Michaelson JS, Leder P. β-catenin is a downstream effector of Wnt-mediated tumorigenesis in the mammary gland. Oncogene. 2001;20:5093–5099. doi: 10.1038/sj.onc.1204586. [DOI] [PubMed] [Google Scholar]
  • 29.Verbeek S, Izon D, Hofhuis F, Robanus-Maandag E, te Riele H, van de Wetering M, Oosterwegel M, Wilson A, MacDonald HR, Clevers H. An HMG-box-containing T-cell factor required for thymocyte differentiation. Nature. 1995;374:70–74. doi: 10.1038/374070a0. [DOI] [PubMed] [Google Scholar]
  • 30.Okamura RM, Sigvardsson M, Galceran J, Verbeek S, Clevers H, Grosschedl R. Redundant regulation of T cell differentiation and TCRα gene expression by the transcription factors LEF-1 and TCF-1. Immunity. 1998;8:11–20. doi: 10.1016/s1074-7613(00)80454-9. [DOI] [PubMed] [Google Scholar]
  • 31.Schilham MW, Wilson A, Moerer P, Benaissa-Trouw BJ, Cumano A, Clevers HC. Critical involvement of Tcf-1 in expansion of thymocytes. J. Immunol. 1998;161:3984–3991. [PubMed] [Google Scholar]
  • 32.Xu Y, Banerjee D, Huelsken J, Birchmeier W, Sen JM. Deletion of β-catenin impairs T cell development. Nat. Immunol. 2003;4:1177–1182. doi: 10.1038/ni1008. [DOI] [PubMed] [Google Scholar]
  • 33.Gounari F, Aifantis I, Khazaie K, Hoeflinger S, Harada N, Taketo MM, von Boehmer H. Somatic activation of β-catenin bypasses pre-TCR signaling and TCR selection in thymocyte development. Nat. Immunol. 2001;2:863–869. doi: 10.1038/ni0901-863. [DOI] [PubMed] [Google Scholar]
  • 34.Mulroy T, McMahon JA, Burakoff SJ, McMahon AP, Sen J. Wnt-1 and Wnt-4 regulate thymic cellularity. Eur. J. Immunol. 2002;32:967–971. doi: 10.1002/1521-4141(200204)32:4<967::AID-IMMU967>3.0.CO;2-6. [DOI] [PubMed] [Google Scholar]
  • 35.Staal FJ, Meeldijk J, Moerer P, Jay P, van de Weerdt BC, Vainio S, Nolan GP, Clevers H. Wnt signaling is required for thymocyte development and activates Tcf-1 mediated transcription. Eur. J. Immunol. 2001;31:285–293. doi: 10.1002/1521-4141(200101)31:1<285::AID-IMMU285>3.0.CO;2-D. [DOI] [PubMed] [Google Scholar]
  • 36.Weerkamp F, Baert MR, Naber BA, Koster EE, de Haas EF, Atkuri KR, van Dongen JJ, Herzenberg LA, Staal FJ. Wnt signaling in the thymus is regulated by differential expression of intracellular signaling molecules. Proc. Natl. Acad. Sci. USA. 2006;103:3322–3326. doi: 10.1073/pnas.0511299103. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 37.Hsu W, Shakya R, Costantini F. Impaired mammary gland and lymphoid development caused by inducible expression of Axin in transgenic mice. J. Cell Biol. 2001;155:1055–1064. doi: 10.1083/jcb.200107066. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 38.Pongracz JE, Parnell SM, Jones T, Anderson G, Jenkinson EJ. Overexpression of ICAT highlights a role for catenin-mediated canonical Wnt signalling in early T cell development. Eur. J. Immunol. 2006;36:2376–2383. doi: 10.1002/eji.200535721. [DOI] [PubMed] [Google Scholar]
  • 39.Cobas M, Wilson A, Ernst B, Mancini SJ, MacDonald HR, Kemler R, Radtke F. β-catenin is dispensable for hematopoiesis and lymphopoiesis. J. Exp. Med. 2004;199:221–229. doi: 10.1084/jem.20031615. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 40.Koch U, Wilson A, Cobas M, Kemler R, Macdonald HR, Radtke F. Simultaneous loss of β- and γ-catenin does not perturb hematopoiesis or lymphopoiesis. Blood. 2008;111:160–164. doi: 10.1182/blood-2007-07-099754. [DOI] [PubMed] [Google Scholar]
  • 41.Jeannet G, Scheller M, Scarpellino L, Duboux S, Gardiol N, Back J, Kuttler F, Malanchi I, Birchmeier W, Leutz A, Huelsken J, Held W. Long-term, multilineage hematopoiesis occurs in the combined absence of β-catenin and γ-catenin. Blood. 2008;111:142–149. doi: 10.1182/blood-2007-07-102558. [DOI] [PubMed] [Google Scholar]
  • 42.Brault V, Moore R, Kutsch S, Ishibashi M, Rowitch DH, McMahon AP, Sommer L, Boussadia O, Kemler R. Inactivation of the β-catenin gene by Wnt1-Cre-mediated deletion results in dramatic brain malformation and failure of craniofacial development. Development. 2001;128:1253–1264. doi: 10.1242/dev.128.8.1253. [DOI] [PubMed] [Google Scholar]
  • 43.Hennet T, Hagen FK, Tabak LA, Marth JD. T-cell-specific deletion of a polypeptide N-acetylgalactosaminyl-transferase gene by site-directed recombination. Proc. Natl. Acad. Sci. USA. 1995;92:12070–12074. doi: 10.1073/pnas.92.26.12070. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 44.Mulroy T, Xu Y, Sen JM. β-catenin expression enhances generation of mature thymocytes. Int. Immunol. 2003;15:1485–1494. doi: 10.1093/intimm/dxg146. [DOI] [PubMed] [Google Scholar]
  • 45.Xu Y, Sen J. β-catenin expression in thymocytes accelerates thymic involution. Eur. J. Immunol. 2003;33:12–18. doi: 10.1002/immu.200390002. [DOI] [PubMed] [Google Scholar]
  • 46.Maretto S, Cordenonsi M, Dupont S, Braghetta P, Broccoli V, Hassan AB, Volpin D, Bressan GM, Piccolo S. Mapping Wnt/β-catenin signaling during mouse development and in colorectal tumors. Proc. Natl. Acad. Sci. USA. 2003;100:3299–3304. doi: 10.1073/pnas.0434590100. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 47.Zhumabekov T, Corbella P, Tolaini M, Kioussis D. Improved version of a human CD2 minigene based vector for T cell-specific expression in transgenic mice. J. Immunol. Methods. 1995;185:133–140. doi: 10.1016/0022-1759(95)00124-s. [DOI] [PubMed] [Google Scholar]
  • 48.Cleverley S, Henning S, Cantrell D. Inhibition of Rho at different stages of thymocyte development gives different perspectives on Rho function. Curr. Biol. 1999;9:657–660. doi: 10.1016/s0960-9822(99)80289-9. [DOI] [PubMed] [Google Scholar]
  • 49.Atcha FA, Syed A, Wu B, Hoverter NP, Yokoyama NN, Ting JH, Munguia JE, Mangalam HJ, Marsh JL, Waterman ML. A unique DNA binding domain converts T-cell factors into strong Wnt effectors. Mol. Cell. Biol. 2007;27:8352–8363. doi: 10.1128/MCB.02132-06. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 50.Shinkai Y, Alt FW. CD3 ε-mediated signals rescue the development of CD4+CD8+ thymocytes in RAG-2−/− mice in the absence of TCR β chain expression. Int. Immunol. 1994;6:995–1001. doi: 10.1093/intimm/6.7.995. [DOI] [PubMed] [Google Scholar]
  • 51.Monick MM, Carter AB, Robeff PK, Flaherty DM, Peterson MW, Hunninghake GW. Lipopolysaccharide activates Akt in human alveolar macrophages resulting in nuclear accumulation and transcriptional activity of β-catenin. J. Immunol. 2001;166:4713–4720. doi: 10.4049/jimmunol.166.7.4713. [DOI] [PubMed] [Google Scholar]
  • 52.Christian SL, Sims PV, Gold MR. The B cell antigen receptor regulates the transcriptional activator β-catenin via protein kinase C-mediated inhibition of glycogen synthase kinase-3. J. Immunol. 2002;169:758–769. doi: 10.4049/jimmunol.169.2.758. [DOI] [PubMed] [Google Scholar]
  • 53.Michie AM, Trop S, Wiest DL, Zuniga-Pflucker JC. Extracellular signal-regulated kinase (ERK) activation by the pre-T cell receptor in developing thymocytes in vivo. J. Exp. Med. 1999;190:1647–1656. doi: 10.1084/jem.190.11.1647. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 54.Xu M, Yu Q, Subrahmanyam R, Difilippantonio MJ, Ried T, Sen JM. Beta-catenin expression results in p53-independent DNA damage and on-cogene-induced senescence in prelymphomagenic thymocytes in vivo. Mol. Cell. Biol. 2008;28:1713–1723. doi: 10.1128/MCB.01360-07. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 55.van de Wetering M, Oosterwegel M, Dooijes D, Clevers H. Identification and cloning of TCF-1, a T lymphocyte-specific transcription factor containing a sequence-specific HMG box. EMBO J. 1991;10:123–132. doi: 10.1002/j.1460-2075.1991.tb07928.x. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 56.van Beest M, Dooijes D, van De Wetering M, Kjaerulff S, Bonvin A, Nielsen O, Clevers H. Sequence-specific high mobility group box factors recognize 10–12-base pair minor groove motifs. J. Biol. Chem. 2000;275:27266–27273. doi: 10.1074/jbc.M004102200. [DOI] [PubMed] [Google Scholar]
  • 57.Staal FJ, Sen JM. The canonical Wnt signaling pathway plays an important role in lymphopoiesis and hematopoiesis. Eur. J. Immunol. 2008;38:1788–1794. doi: 10.1002/eji.200738118. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 58.Ding Q, Xia W, Liu JC, Yang JY, Lee DF, Xia J, Bartholomeusz G, Li Y, Pan Y, Li Z, et al. Erk associates with and primes GSK-3β for its inactivation resulting in upregulation of β-catenin. Mol. Cell. 2005;19:159–170. doi: 10.1016/j.molcel.2005.06.009. [DOI] [PubMed] [Google Scholar]
  • 59.Staal FJ, Burgering BM, van de Wetering M, Clevers HC. Tcf-1-mediated transcription in T lymphocytes: differential role for glycogen synthase kinase-3 in fibroblasts and T cells. Int. Immunol. 1999;11:317–323. doi: 10.1093/intimm/11.3.317. [DOI] [PubMed] [Google Scholar]

RESOURCES