Table 1.
Biological information of the 5 SNPs examined in the study
| NCBI dbSNP ID |
Physical Position |
Chromosome position |
Alleles | MAF | P values for the deviation from HWE1 | Primers and probe sequences / Context sequence ID of ABI primers and probes | |||
|---|---|---|---|---|---|---|---|---|---|
| CEUa | Caucasian1 | Hispanic1 | Caucasian | Hispanic | |||||
| 5-HTTLPR | Promoter | ~25,588,500 | L (long) | - | 0.451 | 0.430 | 0.814 | 0.624 | Forward: TCCT CCGCTTTGGCG CCTCTTCC |
| S(Short) | Reverse: TGGGGGTTGCAGGGGA GATCCTG | ||||||||
| rs25531 | Promoter | 25,588,472 | A/G | 0.100 | 0.065 | 0.079 | 0.999 | 1.000 | Forward: TCCT CCGCTTTGGCG CCTCTTCC |
| Reverse: TGGGGGTTGCAGGGGA GATCCTG The two alleles were determined using restriction enzymes Hpa11 and bcc1 |
|||||||||
| rs6354 | Exon 2 | 25,574,024 | T/G | 0.295 | 0.202 | 0.158 | 0.319 | 1.000 | C_1841706_10 |
| (5′ UTR) | |||||||||
| rs6355 | Exon 3 | 25,572,936 | C/G | 0.025 | 0.022 | 0.026 | 1.000 | 1.000 | C_11414113_20 |
| (Ala/Gly) | |||||||||
| rs28914832 | Exon 10 | 25,562,500 | A/C | 0.008 | 0.003 | 0.009 | 1.000 | 1.000 | (Custom Taqman(R) SNP Genotyping Assay) |
| (Leu/Ile) | Forward: GCAGAAGCGATAGCCAACATG | ||||||||
| Reverse: CAAGCCCAGCGTGATTAACATC | |||||||||
| Probe: CTTTCTTTGCC[C/A]TCATCT | |||||||||
| rs1042173 | Exon 15 | 25,549,137 | G/T | 0.433 | 0.419 | 0.455 | 0.138 | 1.000 | C_7473190_10 |
| (3′ UTR) | |||||||||
MAF = minor allele frequency; HWE = Hardy-Weinberg equilibrium; ABI = Applied Biosystems (Foster City, CA).
a
Note: European sample from HapMap project
1
Data from this study.