Official websites use .gov
A
.gov website belongs to an official
government organization in the United States.
Secure .gov websites use HTTPS
A lock (
) or https:// means you've safely
connected to the .gov website. Share sensitive
information only on official, secure websites.
| Sequence | PCR conditions | |
|---|---|---|
| KiSS-1 | F- TCGTTAATGCCTGGGAAAAG | 96° (5m, 1 cycle) |
| R- CGAAGGAGTTCCAGTTGTAG | 96° (30s) 55°(1m) 72°(1m), | |
| 219 bp | 40 cycles, 72° (7m) | |
| GPR54 | F- GGCTGGTTCCTCTGTTCTTC | 95° (5m, 1 cycle) |
| R- TGGCGATGTAGAAGTTGGTC | 95° (30s) 54°(1m) 72°(1m), | |
| 166 bp | 36 cycles, 72° (7m) | |
| β-actin | F- GAAATCGTGCGTGACATC | 94° (1m, 1 cycle) |
| R- GCTTGCGATCCACATCT | 94° (30s) 55°(1m, 32 cycles) | |
| 500 bp | 72°(1m), 72° (7m) | |
