TABLE 1.

Sequence of the 43-uaY12 revertants

Allele names		Sequence of the mutationb (uaY+: TCATTACGGGTCTTTCAGTT, uaY12: TCATTATGGGTCTTTCAGTT)	No. of revertants selected at
			Nature of the reversiona		25°	37°	Total
uaY12r26	T to A in position −63	TCATTAAGGGTCTTTCAGTT	1	0	1/43
uaY12r11	G to C in position −62	TCATTATCGGTCTTTCAGTT	3	3	6/43
uaY12r17	G to A in position −62	TCATTATAGGTCTTTCAGTT	13	3	16/43
uaY12r49	G to T in position −62	TCATTATTGGTCTTTCAGTT	7	2	9/43
uaY12r43	G to T in position −62 and −61	TCATTATTTGTCTTTCAGTT	1	0	1/43
uaY12r44	G to C in position −62 and −22	TCATTATCGGTCTTTCAGTT	1	0	1/43
		−26 CACCCGTCATTATATCCT
uaY12r130	G to T in position −62 and T to A in −66	TCAATATTGGTCTTTCAGTT	0	2	2/43
uaY12r3	Insertion of T between position −63 and −62	TCATTATTGGGTCTTTCAGTT	1	0	1/43
		See Figure 6
uaY12r18	Deletion of 63 bp from position −91 to −29	See Figure 6	1	0	1/43
uaY12r113	G to A in position −38	See Figure 1	0	1	1/43
uaY12r118	G to A in position −42	See Figure 1	0	2	2/43
12r122 (aas22)	Not in the uaY locus	ND	0	1	1/43
12r128 (aas28)	Not in the uaY locus	ND	0	1	1/43

^aThe positions of these mutations are numbered from the A of the wild-type ATG initiation codon.

^bModified bases in the revertants are in boldface type and in larger type, the underlined letter corresponding to the base mutated in the original uaY12 mutant. The given sequence begins at position −69 relative to the A of the uaY ATG, except indication.