TABLE 1.
Main primers used in this study
Artificial EcoRI sites are underlined. Attached His6 tag sequences are shown in boldface type.
| Name | Sequence (5′-3′) | Purpose |
|---|---|---|
| BmSprORF-fw | GGAGGACAAACCGGAGTCTG | RT-PCR and linkage analysis for lem |
| BmSprORF-re | CCCGCAAGGGGATACGAAGA | RT-PCR and linkage analysis for lem |
| BmSprMfw | CGTAACAAAGATCAGCTCGCCAT | Linkage analysis for leml |
| BmSprMre | CGAGCCTATCCTCTATCTCATC | Linkage analysis for leml |
| pETBmSPR-fw | CGGAATTCGATGGCTATGTCGTCTAGCATC | Expression in E. coli for three proteins |
| pETBmSPR-re1 | CGGAATTCTCAGTGGTGGTGGTGGTGGTGTTCGTCATCGAAATAGTCGAC | Expression in E. coli for normal and leml mutant type proteins |
| pETBmSPR-re2 | CGGAATTCTTAGTGATGGTGATGGTGATGGTCGACGTGCTCTGCCGGACT | Expression in E. coli for lem mutant type protein |