. 2009 Apr 23;15:833–843.

Table 2. Primers for RT–PCR of the RS1 gene.

Primer location	Range	Name	Sequence (5′->3′)	RNA amplification
Primer location	Range	Name	Sequence (5′->3′)	Retina	Blood
Exon 1 and 2	Exon 2–4	93F	GCCACATTGGGATTATCGTC	successful	successful
Exon 4	Exon 2–4	4aR	CGAAGAATACCAGCCCACAT	successful	successful
Exon 1	Exon 1–6	36F	GGGAAGATGTCACGCAAGAT	successful	failed
Exon 6	Exon 1–6	6R	GGTCCGAGTTGCCATAGAAG	successful	failed
Exon 1	Exon 1–6	48F	CGCAAGATAGAAGGCTTTTTG	successful	failed
Exon 6	Exon 1–6	6R	GGTCCGAGTTGCCATAGAAG	successful	failed

Three primer pairs were designed to assess the effect of novel putative splicing mutation c.78+5G>A.