Table 1. PCR primers used to further analyze the opsin array in Family 2.

L or M opsin specific exon 2 PCR primers	5′-3′ Sequence	Product size	Annealing temperature (Ta) °C
LEx2F	ctggatgatctttgtggtcac	192 base pairs (bp)	59
LEx2R	cccagcacgaagtagccag
MEx2F	ctggatgatctttgtggtcat	192 bp	56
MEx2R	cccagcacgaagtagccat
Long Range PCR primers	5′- 3′ Sequence	Product size	Ta °C
LRF	ggctgcactgggggccac	~7–8 kilobases	70
LRR	aagcaaagcttcccactgtcctgcttagac
Internal opsin sequencing primers	5′- 3′ Sequence
Mint1F	tttctcacagctctggaggc
Mint2R	agggagacaggcctaca

Long wave sensitive (L) and Medium wave sensitive (M) opsin specific primer pairs were designed to independently amplify L or M exon 2 sequences. Primer pair LEx2F and LEx2R (Long wave sensitive Exon 2 Forward and Long wave sensitive Exon 2 Reverse) was used to amplify L exon 2 sequence only while primer pair MEx2F and MEx2R was used to amplify M exon 2 sequence only. The Long Range PCR primers (Long Range Forward [LRF] and Long Range Reverse [LRR]) were designed to co-amplify L and M gene sequence spanning the suspected hybrid gene deletion of exon 2 in Family 2. Internal opsin sequencing primers M gene intron 1 Forward (Mint1F) and M gene intron 2 Reverse (Mint2R) were designed to sequence the 7.5 kb PCR product amplified by the Long Range PCR primer pair.