Fig. 4.

Mismatch-dependent, synthesis-driven displacement of DNA segments from a 3′ G–T heteroduplex. Repair reactions as in Fig. 2 contained 3′ G–T heteroduplex DNA, MutSα, MutLα, RFC, PCNA, RPA, DNA polymerase δ, and ATP (MMR set) plus the 4 dNTPs, with individual additions/omissions as indicated (lanes 2, 4–9 and 12). Results obtained with otherwise identical A·T homoduplex DNAs are shown in lanes 13 and 14. For the reactions shown in lanes 10 and 11, MutLαD699N was substituted for wild-type MutLα. The reactions were analyzed by Southern hybridization assay as detailed in Materials and Methods with a ³²P-labeled oligonucleotide [d(gctttcgagtctagaaattcggct)] complementary to that portion of the incised DNA strand spanning the mismatch as a probe. Sizes shown on the right (kB) are based on duplex DNA markers. Comparative electrophoresis of double- and single-stranded markers indicated that displaced DNA segments in lane 3 range in size from ≈70 to 300 nt.