Figure 2.

ADAM9 Mutations in CORD9 Patients

(A) Pedigrees of three of the CORD families with genomic DNA sequence of the ADAM9 mutations they carry. The two members of the Brazilian CORD9 family genotyped for refinement of the locus are indicated by arrows. All mutations were shown to segregate with the phenotype in each family by direct sequencing.

(B) Pedigree of MOL0277 with genomic and cDNA sequences from mRNA of an affected family member versus an unaffected control individual. cDNA was generated by the Verso cDNA kit according to the manufacturer's protocol. The following primers were designed to amplify through exon 6: forward, GACCTTTTGCCTGAAGATTTTG (5′–3′ located within exon 4); reverse, TCCAAGTAGTTTGCCAGGAG (5′–3′ located within exon 8). The base change at position c.411-8 A→G. and the 7 bp insertion from the 3′ end of intron 5 in the RNA transcript are highlighted.