Official websites use .gov
A
.gov website belongs to an official
government organization in the United States.
Secure .gov websites use HTTPS
A lock (
) or https:// means you've safely
connected to the .gov website. Share sensitive
information only on official, secure websites.
Distribution of the ATTTCAATCCCATTTTGGTCTGAT TTTAAC (30 bp) repeat within the complete genome sequence of M. thermoautotrophicus. The x-axis represents the number of unit length repeats, i.e., each consecutive occurrence of the repeat sequence was assigned a number from 1 through n (repeat number) where n is the total copy number of the repeat within the genome. The y-axis represents the period distance or periodicity, i.e., the spacer length between consecutive repeats.
