Table 1.

PCR primers, amplicon sizes and function of genes selected for qRT-PCR analysis.

Gene	Accession no.	Forward primer (5' – 3')	Reverse primer (5' – 3')	Size (bp)	Function (from mammalian homologs)
BMI1 polycomb ring finger oncogene	EX738556	CAGGCGGCAAACAAGAGGTA	ATGACTTCAACCTGGTAGGTGTTG	113	Component of the Polycomb group (PcG) multiprotein PRC1 complex, a complex required to maintain the transcriptionally repressive state of many genes, including Hox genes, throughout development. PcG PRC1 complex acts via chromatin remodeling and modification of histones; it mediates monoubiquitination of histone H2A 'Lys-119', rendering chromatin heritably changed in its expressibility. In the PRC1 complex, it is required to stimulate the E3 ubiquitin-protein ligase activity of RNF2/RING2
One-eyed pinhead protein	EX737753	AGAACGGAGGGACGTGCAT	TCTGAACCCACTCCCCATGA	126	Involved in the correct establishment of the left-right axis. May play a role in mesoderm and/or neural patterning during gastrulation
Ovary-expressed homeobox protein (shows similarity to Nanog)	EX736873	AGCCCAATCGGGACTCACTT	TTCTTGGCATTGTAGTGCTCAGA	117	Transcription regulator involved in inner cell mass and embryonic stem (ES) cells proliferation and self-renewal. Imposes pluripotency on ES cells and prevents their differentiation towards extraembryonic endoderm and trophectoderm lineages. Blocks bone morphogenetic protein-induced mesoderm differentiation of ES cells by physically interacting with SMAD1 and interfering with the recruitment of coactivators to the active SMAD transcriptional complexes (by similarity). Acts as a transcriptional activator or repressor (by similarity). Binds optimally to the DNA consensus sequence 5'-[CG] [GA] [CG]C [GC]ATTAN [GC]-3' (by similarity). When overexpressed, promotes cells to enter into S phase and proliferation (by similarity)
Pre-mRNA-processing factor 19 (PRP19)	EX738721	GGACCGACCCGATGAATG	CCTGGAGGGACTTGAGAATGG	126	Plays a role in DNA double-strand break (DSB) repair and pre-mRNA splicing reaction. Binds double-stranded DNA in a sequence-nonspecific manner. Acts as a structural component of the nuclear framework. May also serve as a support for spliceosome binding and activity. Essential for spliceosome assembly in a oligomerization-dependent manner and might also be important for spliceosome stability. May have E3 ubiquitin ligase activity. The PSO4 complex is required in the DNA interstrand cross-links (ICLs) repair process. Overexpression of PRPF19 might extend the cellular life span by increasing the resistance to stress or by improving the DNA repair capacity of the cells

The descriptions of gene function were obtained from the GeneCards database [13] of human homologs.