. 2009 Apr 10;191(12):4047–4050. doi: 10.1128/JB.00313-09

TABLE 2.

Summary of mutations introduced into the two boxes that form the upstream inverted repeat and activities of wild-type and mutated icsP promoter fragments

Fragment description	Sequence^a	β-Galactosidase activity^b
Fragment description	Sequence^a	virB⁺	virB mutant
WT box 1 and 2	`CGGGGATTTCAGTATGAAATGAAGTA`	4,412 ± 80	388 ± 10
Mutated box 1	`CGGGGATTTCAGTCGACCCGGAAGTA`	307 ± 13	326 ± 75
Mutated box 2	`CGGGGGCCCAGCTATGAAATGAAGTA`	309 ± 27	345 ± 22
Mutated box 1 and 2	`CGGGGGCCCAGCTCGACCCGGAAGTA`	297 ± 18	341 ± 15
Promoterless lacZ		284 ± 13	388 ± 25

5′→3′ DNA sequences of the wild-type and mutated boxes that form the upstream inverted repeat. Sequences lie between positions −1144 and −1130 relative to the annotated transcription start site of icsP (+1) (8). Underlined sequences are box 2 (left) and box 1 (right) sequences.

All promoter fragments were fused to lacZ, and β-galactosidase activities were measured in wild-type S. flexneri (2457T) and the isogenic strain that lacks virB (AWY3). The parent cloning vector with a promoterless lacZ gene was included as a negative control. β-Galactosidase activities are expressed in Miller units. Assays were run in triplicate, and the means and standard deviations of the results are shown.