TABLE 1.
Primers used for long-distance and quantitative RT-PCRs in this study
| Test and region(s) | Direction | Primer(s)a | Sequenceb | Positionc |
|---|---|---|---|---|
| Long-distance PCR | ||||
| 5′ UTR-NS3 | RT | 606R/712R | GTTTCCATAGACTC(A/G)ACGGG | 3930-3949 |
| 5′ UTR-NS3, 5′ UTR-NS5B | 1st forward | 420 | GGCGACACTCCACCATAGATCACTC | 1-42 |
| 5′ UTR-NS3 | 1st reverse | 605R/713R | ACCGGAATGACATCAGCATG(T/C)CTCGT | 3741-3766 |
| 5′ UTR-NS3, 5′ UTR-NS5B | 2nd forward | AscT7-420 | ATCGTAGGCGCGCCTCTAATACGACTCACTATAGC | 1-42 |
| CAGCCCCCGATTGGGGGCGACACTCCACCATAGATCACTC | ||||
| 5′ UTR-NS3 | 2nd reverse | 604R/714R | CGAGGTCCTGGTCTACATT(G/A)GTGTACAT | 3639-3666 |
| NS3-NS5B, 5′ UTR-NS5B | RT | 386R | AATGGCCTATTGGCCTGGAG | 9390-9392 |
| NS3-NS5B | 1st forward | 602/723 | CCACCGCAACACAATCTTTCCT(G/A)GCGAC | 3529-3556 |
| NS3-NS5B, 5′ UTR-NS5B | 1st reverse | 719R/720R/721R | GAGTGTTTAGCTCCCCGTTCA(T/C/G)CGGTTGGG | 9363-9392 |
| NS3-NS5B | 2nd forward | 603/724 | CAAAGGGTCCAATCACCCA(A/G)ATGTACAC | 3619-3646 |
| NS3-NS5B, 5′ UTR-NS5B | 2nd reverse | 607R/654R/722R | CGGTTGGGGAGCAGGTA(G/A/G)A(T/T/C)GCCTAC | 9345-9370 |
| Quantitative PCR | ||||
| 5′ UTR | RT | 738RH | ACTCGCAAGCACCCTATCAGGC | 291-312 |
| 5′ UTR | Forward | 736 | AAGCGTCTAGCCATGGCGTTAGTA | 73-96 |
| 5′ UTR | Reverse | 737R | GGCAGTACCACAAGGCCTTTCG | 272-293 |
| 5′ UTR | Probe | 733FB | FAM-TCTGCGGAACCGGTGAGTACAC-BHQ1 | 147-168 |
| E2 | RT | 743RH/744RH/753RH/753RH | CAACGCTCTCCTCG(A/A/G/G)GTCCA(A/G/A/G)TTGCA | 2271-2296 |
| E2 | Forwardd | 751/752 | GGCCTCCACATGGCAA(C/T)TGGTTCGG | 1972-1993 |
| E2 | Forwardd | 739/740 | CCGCCGCAAGGCAACTGGTT(C/T)GG | 1974-1993 |
| E2 | Reverse | 741R/742R | GCCTCGGGGTGCTTCCGGAAGCA(G/A)TCCGT | 2088-2116 |
| E2 | Probe | 734FB/735FB | FAM-TGGATGAA(T/C)AGCACTGGGTTCACCAAGAC-BHQ1 | 2001-2029 |
a
Primers separated by slashes harbor a nucleotide substitution(s) (in parentheses) in the sequence in the same order.
b
An underline and a double underline indicate recognition sequences for AscI and BsrGI, respectively, with which the PCR products were subcloned into plasmid vector pASGT5. Italics denote the T7 promoter, which was used to synthesize RNA in vitro from the T5S2 isolate (Fig. 4A).
c
Nucleotide positions correspond to the HCV-JS sequence (12).
d
Forward primers for E2 were mixed in the reaction mixture.