1μg DNA containing sh-ghsr pSUPER (a) or just vehicle (E, not including pSUPER) was injected bilaterally at the PVN, suspended in 1μl of the NeuroFECT transfection reagent. After 8 days of transfection, RNA was isolated from the PVN and reverse transcribed. cDNAs were PCR-amplified using primers for M13. PVN samples injected with sh-ghsr pSUPER showed a PCR product at 480bp (lane a 2) whereas PVN samples injected with transfection reagent only (E 2) showed no PCR product. All samples were also PCR amplified with gapdh primers as positive controls (E 1 & a 1; 583bp).
Primer pair sequences for gapdh (forward:ctgagaatgggaagctggtcatca and reverse: tcatacttggcaggtttctccagga; and accession number is NM_017008)