Official websites use .gov
A
.gov website belongs to an official
government organization in the United States.
Secure .gov websites use HTTPS
A lock (
) or https:// means you've safely
connected to the .gov website. Share sensitive
information only on official, secure websites.
Primer sequences, amplification sizes and annealing temperatures used in RT-PCR.
| Primer sequence(5' -> 3') | Amplification range | PCR setting Annealing Number of cycles | |
|---|---|---|---|
| Kaiso | TGCCTATTATAACAGAGTCTTT | 719–966 (NM_006777.3) | 50°C, 40 sec 30 cycles |
| AGTAGGTGTGATATTTGTTAAAG | |||
| Matrilysin | TCTTTGGCCTACCTATAACTGG | 241–660 (NM_002423.3) |
53°C, 40 sec 35 cycles |
| CTAGACTGCTACCATCCGTC | |||
| β-Actin | AGAGCTACGAGCTGCCTGAC | 797–1096 (NM_001101.3) |
55°C, 40 sec 30 cycles |
| AGTACTTGCGCTCAGGAGGA | |||
