Table 1.
shRNA target sites and the efficiency of CCR5 reduction in MAGI-CCR5 cells
| Target region | Target sequence | Nucleotide position | CCR5 reduction on MAGI-CCR5 |
| CCR5-1 | aagtgtcaagtccaatctatgac | 13 | +++ |
| CCR5-2 | aagagcatgactgacatctacct | 186 | ++ |
| CCR5-3 | ctgacaatcgataggtacctggc | 366 | - |
| CCR5-4 | gtgacaagtgtgatcacttgggt | 442 | - |
| CCR5-5 | ttgtcatggtcatctgctactgg | 624 | ++ |
| CCR5-6 | cagtagctctaacaggttggaca | 809 | + |
| CCR5-7 | aaggtcttcattacacctgcagc | 517 | +/- |
| CCR5-8 | aagttcagaaactacctcttagt | 909 | +++ |
Eight shRNAs against human CCR5 were selected by a published algorithm[7]. shRNA target sequences are shown in the second column. Corresponding nucleotide positions of the target sequence in CCR5 mRNA are shown in the 3rd column. MAGI-CCR5 cells were transduced with lentiviral vectors expressing shRNA under the U6 promoter. To determine the expression levels of CCR5 on cell surface, the cells were cultured for 4 days and stained with APC conjugated anti-human CCR5 monoclonal antibody. The reduction levels of in EGFP+ population was analyzed by flow cytometry and shown as following criteria (+++ more than 10 fold reduction, ++ 10 fold reduction, + 3–5 fold reduction, +/- 2 fold reduction, – no reduction).