Skip to main content
. 2009 Jun 10;7:8. doi: 10.1186/1479-0556-7-8

Table 1.

shRNA target sites and the efficiency of CCR5 reduction in MAGI-CCR5 cells

Target region Target sequence Nucleotide position CCR5 reduction on MAGI-CCR5
CCR5-1 aagtgtcaagtccaatctatgac 13 +++

CCR5-2 aagagcatgactgacatctacct 186 ++

CCR5-3 ctgacaatcgataggtacctggc 366 -

CCR5-4 gtgacaagtgtgatcacttgggt 442 -

CCR5-5 ttgtcatggtcatctgctactgg 624 ++

CCR5-6 cagtagctctaacaggttggaca 809 +

CCR5-7 aaggtcttcattacacctgcagc 517 +/-

CCR5-8 aagttcagaaactacctcttagt 909 +++

Eight shRNAs against human CCR5 were selected by a published algorithm[7]. shRNA target sequences are shown in the second column. Corresponding nucleotide positions of the target sequence in CCR5 mRNA are shown in the 3rd column. MAGI-CCR5 cells were transduced with lentiviral vectors expressing shRNA under the U6 promoter. To determine the expression levels of CCR5 on cell surface, the cells were cultured for 4 days and stained with APC conjugated anti-human CCR5 monoclonal antibody. The reduction levels of in EGFP+ population was analyzed by flow cytometry and shown as following criteria (+++ more than 10 fold reduction, ++ 10 fold reduction, + 3–5 fold reduction, +/- 2 fold reduction, – no reduction).

HHS Vulnerability Disclosure