Skip to main content
NCBI home page
NIHPA Author Manuscripts logoLink to NIHPA Author Manuscripts
. Author manuscript; available in PMC: 2009 Jul 1.
Published in final edited form as: Mol Microbiol. 2009 Mar 17;72(2):491–505. doi: 10.1111/j.1365-2958.2009.06664.x

HlyU acts as an H-NS antirepressor in the regulation of the RTX toxin gene essential for the virulence of the human pathogen Vibrio vulnificus CMCP6

Moqing Liu 1, Hiroaki Naka 1, Jorge H Crosa 1,*
PMCID: PMC2704492  NIHMSID: NIHMS118234  PMID: 19320834

Summary

In Vibrio vulnificus, HlyU up-regulates the expression of the large RTX toxin gene. In this work we identified the binding site of HlyU to -417 to -376 bp of the rtxA1 operon transcription start site. lacZ fusions for a series of progressive deletions from the rtxA1 operon promoter showed that transcriptional activity increased independently of HlyU when its binding site was absent. Thus HlyU must regulate the rtxA1 operon expression by antagonizing a negative regulator. Concomitantly we found that an hns mutant resulted in an increase in the expression of the rtxA1 operon genes. Multiple copies of HlyU can increase the promoter activity only in the presence of H-NS underscoring the hypothesis that HlyU must alleviate the repression by this protein. H-NS binds to a region that extends upstream and downstream of the rtxA1 operon promoter. In the upstream region it binds to five AT-rich sites of which two overlap the HlyU binding site. Competitive footprinting and gel shift data demonstrate HlyU’s higher affinity as compared to H-NS resulting in the de-repression and a corresponding increased expression of the rtxA1 operon.

Keywords: Vibrio vulnificus, antirepressor, RTX toxin, virulence

Introduction

Vibrio vulnificus is an opportunistic marine pathogen that can cause a fatal septicemic disease in eels and in humans after consumption of raw or undercooked seafood (Amaro et al., 1995). The infection can also be acquired through open wounds when exposed to water contaminated with the pathogen. This estuarine bacterium preferentially affects individuals that are heavy drinkers of alcohol and patients with underlying hepatic diseases and other compromised conditions, such as hemochromatosis and beta thalassemia (Hlady and Klontz, 1996; Morris, 1988; Strom and Paranjpye, 2000). The pathogen frequently causes fatal primary septicemia with a very rapid progress, resulting in a mortality rate of more than 50% within a few days (Linkous and Oliver, 1999; Lee et al., 2000; Chiang and Chuang, 2003; Potasman et al., 2002).

A range of virulence factors have been proposed to play a role in the pathogenesis of this disease including capsular polysaccharides (Smith and Siebeling, 2003; Wright et al., 1999), flagella (Lee et al., 2004; Kim and Rhee, 2003), hemolysin (Chen et al., 2004), protease (Kothary and Kreger, 1987), pili (Paranjpye et al., 2007; Paranjpye and Strom, 2005), and the siderophore vulnibactin (Litwin et al., 1996). More recently regulation of fatty acid metabolism by FadR (Brown and Gulig, 2008), as well as iron-regulated genes and a small RNA were demonstrated to also play a role as virulence attributes for V. vulnificus (Alice et al., 2008).

Our laboratory (Liu et al., 2007) and others (Lee et al., 2007) demonstrated that the RTX (repeats in toxin) toxin is an important virulence factor in V. vulnificus infections. This protein is a homologue of the V. cholerae RTX toxin being even larger than the latter. We reported that rtxA1 expression in V. vulnificus requires the transcriptional regulator HlyU (Liu et al., 2007), that was previously demonstrated to be expressed in vivo and is associated with the virulence phenotype (Kim et al., 2003). The HlyU protein belongs to a family of small regulatory proteins that includes NolR of Rhizobium meliloti, SmtB of Synechococcus sp., and ArsR of Staphylococcus aureus (Williams et al., 1993). The purified V. cholerae HlyU protein possesses two cysteine residues and is predominantly alpha-helical (Saha et al., 2006). Analysis of the modeled structure of this protein revealed that although HlyU exhibits structural features common to the SmtB/ArsR family of transcriptional repressors it does not have the key metal-sensing residues like other members of this family (Saha and Chakrabarti, 2006).

Our observation indicated that HlyU acts by directly binding to a region located upstream of the start codon of the first gene of the rtxA1 operon (Liu et al., 2007). However, since the HlyU binding site is far upstream of the predicted promoter it could not explain the mechanism by which HlyU regulates the expression of rtxA1. The importance of RtxA1 in the pathogenesis of the disease caused by V. vulnificus, prompted us to investigate the molecular mechanism by which HlyU up-regulates rtxA1 expression. In this study we demonstrate that HlyU is not a direct activator but acts as an antirepressor to alleviate the repression of rtxA1 by H-NS.

Results

Mapping the transcription start site of the rtxA1 operon

In our previous work we demonstrated that RtxA1 is an important virulence factor in V. vulnificus and that the HlyU protein, another virulence factor, could act as a positive regulator of the rtxA1 operon by directly binding to a region located within 487 to 750 bp upstream of the putative start codon of VV20481 (the first gene in the rtxA1 operon) (Liu et al., 2007). To determine the transcription start site of this promoter, a modified RNA ligase-mediated rapid amplification of cDNA ends (RLM-RACE) experiment was performed. This assay detects 5’ ends of bacterial RNAs and differentiates initiated transcripts from those just processed by identifying the differences between amplification products generated with tobacco acid pyrophosphatase (TAP)-treated vs untreated RNA samples as templates for cDNA synthesis and PCR. It is obvious that the TAP-treated sample produced one extra band compared to the untreated sample when the primers 2 (RACE20481-R-in) and 3 (5’ RACE outer primer) were used in the PCR reaction (Fig. 1A and 1B). After the DNA from the bands was cloned and sequenced we were able to determine that the rtxA1 operon transcription start site maps to the adenine residue (designated position +1) at 227 bp upstream of the putative start codon of VV20481. The sequence from the second band suggested that the cytosine residue at 165 bp upstream of the putative start codon is a processing point for this mRNA. Inspection of the sequence immediately upstream of the transcription start site showed the presence of the characteristic -10 (TAATAT) and -35 (TTGATG) hexamers for a σ70 promoter (Fig. 1C).

Fig.1.

Fig.1

Open in a new tab

The modified RLM-RACE to determine the transcription start site of the rtxA1 operon. (A) Location of the primers in the RLM-RACE experiment. Small arrows represent the location of primers. Primer 1, P20481-R; primer 2, RACE20481-R-in; primer 3, 5’RACE outer primer. (B) The PCR results from primer 3 (the adapter-specific 5’ RACE outer primer) and primer 2; the asterisk points out the extra band from the TAP-treated sample compared with the TAP-untreated sample. MW, DNA molecular weight marker. (C) Sequence analysis of the upstream region of the rtxA1 operon promoter. The transcription start site is indicated by the bent arrow. The -10 and -35 regions are underlined. The processing point of the mRNA is double underlined, and the putative translation start site is in italics.

Based on the RACE results and the previous gel shift (Liu et al, 2007), we deduced that HlyU binds at a region located between 260 and 523 bp upstream of the transcription start site of the rtxA1 operon. This distance is rather large for HlyU to just act as a conventional positive regulator interacting directly with the RNA polymerase. To determine whether there are other transcripts initiated between the identified transcription start site and the HlyU binding site that were not detected by the RLM-RACE approach, we performed a ribonuclease protection assay (RPA) using the RNA probes a’, b’ and c’ to hybridize with total RNA purified from the wild type strain followed by ribonuclease treatment to cleave the un-hybridized RNA (Fig. 2A). For probes b’ and c’, there was no signal detected. However, for probe a’, two bands with a smaller size than the whole probe were detected (band I is for the RNA from +91 to the transcription start site and band II is for the RNA from +91 to the processing site) demonstrating that there is no other transcript initiated between the identified rtxA1 operon transcription start site and the HlyU binding site (Fig. 2B).

Fig. 2.

Fig. 2

Open in a new tab

Ribonuclease protection assay (RPA) to detect other transcript(s) initiated between the identified transcription start site and the HlyU binding site. (A) Location of the probes used in RPA: probe a’, +91 to -69; probe b’, -99 to −278, and probe c’, -359 to -523. The capital “A” stands for the transcription start site; the black bar represents the HlyU binding site. (B) The results from the RPA. The total RNA from the wild type CMCP6 cells was hybridized with probes a’, b’ and c’ respectively, then treated with RNase A and RNase T1. Lanes 1, 3 and 5 are the ribonuclease protection results for probe a’, b’ and c’ respectively; lanes 2, 4 and 6 stand for a’, b’ and c’ probe only, respectively.

Identification of the nucleotide sequence bound by HlyU in the regulatory region of the rtxA1 operon

We previously demonstrated that HlyU only binds to fragment d located at an upstream region far from the promoter (Liu et al, 2007) (Fig. 3A). In this study, we further identified the nucleotide sequence bound by HlyU in this fragment using DNase I footprinting. The 32P-labeled 294-bp DNA fragment d was incubated with increasing concentrations (25 nM and 100 nM) of the purified HlyU-His protein and then treated with DNase I (Fig. 3B). As a control, a labeled DNA probe without HlyU was also exposed to DNase I treatment. A protection pattern was identified in the regulatory region located between 376 and 417 bp upstream of the VV20481 transcription start site. This HlyU binding site is very AT-rich and it has an imperfect palindromic pattern.

Fig. 3.

Fig. 3

Open in a new tab

DNase I protection by HlyU at the upstream region of the rtxA1 operon promoter. (A) Location of the DNA probe fragments a (+279 to +89), b (+111 to -29), c (-30 to -279), and d (-260 to -523). (B) DNase I footpringting assay by HlyU and fragment d. The coding strand of the fragment extending from -523 to -260 bp of the transcription start site was incubated with increasing concentrations of HlyU and treated with DNase I. Lane 1, no protein; lane 2-3, HlyU, 25 nM and 100 nM, respectively. Lanes A, C, G and T represent the nucleotide sequencing ladders of pTopo-FP-P20481. The open bar indicated the protection region from 417 to 376 bp upstream of the transcription start site with the sequence TGTAATTATTAGTTTTTGTTAAATTAGCATTTTCTTTAAATT.

Deletion analysis of the rtxA1 operon promoter region

Information on the mode of regulation of the rtxA1 operon by the HlyU protein could be obtained by construction of a deletion of the HlyU binding site and assessing the expression of the genes in the rtxA1 operon. For this task, a series of promoter fragments harboring progressively shorter upstream sequences of the promoter regulatory region were generated by PCR, and then each of the DNA fragments was transcriptionally fused to the lacZ gene in plasmid pTL61T. The behavior of the various promoter derivatives was examined by β-galactosidase analysis in V. vulnificus hlyU+ and hlyU- strains (Fig. 4). The β-galactosidase activity of fusion pTL-523, in which the end-point is at -523 bp and that includes the HlyU binding site, is higher in the hlyU+ strain as compared to that in the hlyU- strain. These results are consistent with the hypothesis that HlyU must play a positive regulatory role. Fusion pTL-428 in which 95-bp were deleted from the 5’-end without affecting the HlyU binding site exhibited a minor increase (approximately 1.6-fold) in the hlyU+ background whereas it showed a major enhancement in the hlyU- background (4.1-fold) as compared to pTL-523. Furthermore the β-galactosidase activity levels of the pTL-428 fusion in the hlyU+ and hlyU- backgrounds were now similar. In fusions pTL-347 and pTL-278 in which the HlyU binding sites were absent, the levels of expression remained similar to those obtained with fusion pTL-428, i.e. higher than pTL-523. The deletion of 488-bp from the 5’- end resulting in a fragment containing just the -35 and -10 sites of the promoter (pTL-35), showed a defect in promoter activity compared with the full-length promoter fragment (pTL-523) suggesting that the RNA polymerase binding site alone (only -35 and -10 sites) is not enough for the full activity of this promoter. In summary, deletions of the upstream region resulted in an increase in the basal transcription of the rtxA1 promoter independently of the presence of HlyU. However, our previous evidence strongly suggested that HlyU is a positive regulator that might act by binding at a region between 376 and 417 bp upstream of the transcription start site. This apparent paradox could be solved considering that HlyU, rather than acting as a direct activator, it actually operates by relieving the action of a repressor that according to the deletion results must bind to a region near the HlyU binding site.

Fig. 4.

Fig. 4

Open in a new tab

Promoter activities of various lacZ transcriptional fusions in the hlyU+ (ΔlacZ) and hns- (ΔlacZ ΔhlyU) strains. The figures described the promoter fragments which were fused to lacZ gene in pTL-523, pTL-428, pTL-347, pTL-278 and pTL-35, repectively (from up to down). The numbers in the right panel represents β-galactosidase activities for these fusion plasmids in the strains indicated. β-galactosidase activities were determined as described by Miller (Miller, 1992). The data are mean values from 3 independent experiments (± standard deviation). ΔlacZ, ALE-LAC; ΔlacZ ΔhlyU, MQ4.

H-NS represses the expression of the rtxA1 operon

Since the H-NS protein is a known gene repressor in many bacteria (Lithgow et al., 2007; Tendeng and Bertin, 2003; Corbett et al., 2007; Ghosh et al., 2006; Beloin and Dorman, 2003; Banos et al., 2008; Poore and Mobley, 2003; Navarre et al., 2006; Olekhnovich and Kadner, 2007), we decided to evaluate whether it is H-NS that influences the expression of the rtxA1 operon genes. According to the genomic annotation, in V. vulnificus CMCP6 there are two H-NS homologues, VV12923 and VV10374 that share 32% identity. Mutation of VV12923 resulted in an increase in the transcription level of the rtxA1 and VV20481 genes 15.9- and 11.2-fold respectively (Table 1) whereas mutation of VV10374, did not affect their expression (data not shown). Therefore, in the rest of this work we will use the hns designation only for VV12923. We then compared the expression of the lacZ fusion pTL-523 in the hns+ and hns- strains (Table 2). In the absence of H-NS, the level of β-galactosidase activity in the pTL-523 fusion was 16,230 units while it was only 7558 units in the hns+ background. To test whether the hns mutation was solely responsible for this phenotype, pTL-523 was introduced into the regenerated wild-type strain created by eliminating the inserted plasmid pDM4 from the hns gene. Clearly, the β-galactosidase activity of the lacZ fusion in the regenerated hns wild type strain went back down to the wild type level. These results clearly show that H-NS or an H-NS-associated factor negatively regulates the expression of the rtxA1 operon.

Table 1.

Real-time RT-PCR analysis

Gene Relative change (n-fold) in expression abc
ΔlacZ hns∷pDM4 /ΔlacZ ΔlacZ hns∷pDM4 / ΔlacZΔ hlyU hns∷pDM4
VV20481 + 11.2 ± 1.7 - 1.2 ± 0.3
rtxA1 + 15.9 ± 8.6 - 1.6 ± 0.5
Open in a new tab
a

ΔlacZ hns∷pDM4, MQ5; ΔlacZ, ALE-LAC; ΔlacZ ΔhlyU hns∷pDM4, MQ6.

b

The data are mean values from 3 independent experiments (± standard deviation).

c

Gene expression is up-regulated (positive value) or down-regulated (negative value).

Table 2.

Repression of promoter-lacZ fusion by H-NS

Strains a β-galactosidase activity (Miller units) bc
ΔlacZ / pTL-523 7558 ± 1022
ΔlacZ hns∷pDM4 / pTL-523 16230 ± 4000
hns restore strain / pTL-523 6455 ± 2580
Open in a new tab
a

ΔlacZ (hns+ strain), ALE-LAC; ΔlacZ hns∷pDM4 (hns- strain), MQ5; pTL-523, lacZ fusion plasmid; hns restore strain, the pDM4 suicide plasmid is cured from MQ5.

b

β-galactosidase activities were determined as described by Miller (Miller, 1992).

c

The data are mean values from 3 independent experiments (± standard deviation).

Does HlyU operate by alleviating the repression by H-NS?

Our data so far indicate that HlyU might not be a direct activator, and that H-NS plays a negative role on the regulation of the rtxA1 operon. To determine whether HlyU acts as an antirepressor of H-NS, we measured the β-galactosidase activities from cultures of hns+ and hns- strains carrying the lacZ fusion pTL-523 and a multi-copy hlyU expression plasmid (pMMB-hlyU). As control, we used a strain carrying the pTL-523 and the empty vector pMMB208K. The presence of the multi-copy hlyU in pMMB-hlyU increased the expression of the rtxA1 operon by 2-fold in the parental strain (Figure 5). In contrast, in the absence of the H-NS protein, over-expression of HlyU did not enhance the expression of the rtxA1 operon. Furthermore, comparison of the expression of the VV20481 and rtxA1 genes by real-time RT-PCR between the hns mutant and the hlyU hns double mutant confirmed this result (Table 1). Therefore, we conclude that HlyU activates the expression of the rtxA1 operon by attenuating the repressing effects of H-NS and that HlyU has no direct activation role in the absence of H-NS or an H-NS-associated factor.

Fig. 5.

Fig. 5

Open in a new tab

β-galactosidase activity assay of the V. vulnificus hns+ (ΔlacZ) and hns- (ΔlacZ hns∷pDM4) strains harboring the lacZ-fusion plasmid and the hlyU multicopy plasmid. ΔlacZ, ALE-LAC; ΔlacZ hns∷pDM4, MQ5; pTL-523, lacZ fusion plasmid; pMMB, pMMB208K; pMMB-hlyU, pMMB208K derivative containing the wild-type hlyU gene. β-galactosidase activities were determined as described by Miller (Miller, 1992). The data are mean values from 3 independent experiments (± standard deviation).

How does H-NS repress expression at the distant rtxA1 operon promoter?

To determine whether H-NS represses the expression of the rtxA1 operon by directly binding to the promoter regulatory region or indirectly by involving other regulator(s), we performed gel mobility shift assays using the purified H-NS-His6 protein. We previously described that HlyU only binds to the promoter fragment d and not to a, b, or c (Fig. 3A) (Liu et al, 2007). Therefore, we first examined whether H-NS can interact with DNA within fragment d (Fig. 6A). At low concentrations of the H-NS protein (0.1-0.5 μM), no shift was observed. Increasing concentrations of the H-NS protein up to 0.6 and 0.7 μM, resulted in obvious shifts. We confirmed the specificity of these shifts by adding to the binding reaction an excess of the unlabeled specific (Fig. 6A, lane 12) and non-specific (Fig. 6A, lane 13) DNA fragments before the addition of the H-NS protein. To further locate the H-NS binding site(s) on fragment d we carried out DNase I footprinting assays using increasing concentrations of the H-NS protein. When up to 0.5 μM of H-NS were added in the binding reactions, no H-NS protection was observed (Fig. 6B). This result is consistent to those observed in the gel mobility shift assays; i. e., low concentrations of the H-NS protein could not bind to the promoter region. When the H-NS concentration increased up to 0.8 μM in the binding reaction, an obvious protection pattern appeared and remained at higher concentrations of H-NS. The H-NS protection sites include sequences located at: -459 to -430 (site I), -422 to -392 (site II), -389 to -362 (site III), -353 to -328 (site IV) and -322 to -289 (site V). These sequences cover nearly all of the fragment d except for some high GC region (Fig. 6C). This is not surprising since H-NS generally binds at AT-rich sites. It is specially worth noting that the H-NS binding sites II and III overlap with the HlyU binding site.

Fig. 6.

Fig. 6

Open in a new tab

H-NS binds to the far upstream region of the rtxA1 operon promoter. (A) Gel mobility shift assay for the binding of the H-NS protein to the fragment d. The labeled DNA fragment (5 nM) was mixed with varying concentrations of H-NS protein as indicated. For the competition analysis, the unlabeled DNA was used as a competitor. Before addition of 1 μM H-NS, 300 nM of unlabeled specific competitor DNA (lane 12) or 300 nM of unlabeled non-specific competitor DNA (lane 13) which is from 150 bp of rtxA1 gene was added to the reaction containing a 5 nM concentration of the labeled DNA probe. (B) Identification of H-NS binding sites using DNase I footprint analysis. The coding strand of DNA relative to the fragment d was incubated with increasing concentrations of H-NS and treated with DNase I. Lane 1, no protein; lane 2-6, H-NS (0.2, 0.5, 0.8, 1.5, 3.0 μM respectively). Lanes A, C, G and T represent the nucleotide sequencing ladders of pTopo-FP-P20481. The black bars (I, II, III, IV and V) indicate the H-NS protection sites. (C) The sequence of H-NS protection region in the DNase I footprinting analysis is underlined and the region protected by HlyU is in italics.

H-NS normally interferes with RNA-polymerase action at the promoter site. How does therefore H-NS repress expression at the distant rtxA1-operon promoter? To answer this question we performed gel shift assays of fragments a, b and c in the presence of H-NS and found that these three fragments also caused shifts indicating that H-NS can bind multiple upstream and downstream regions in the rtxA1 operon promoter possibly allowing H-NS-mediated DNA bridging to create a repressive complex (Fig. 7).

Fig. 7.

Fig. 7

Open in a new tab

H-NS binds to the region from upstream to downstream of the rtxA1 operon promoter. Gel mobility shift assay for the binding of the H-NS protein to the fragment a, b, and c. The labeled DNA fragment (5 nM) was mixed with varying concentrations of H-NS protein as indicated. For the competition analysis, the excess of unlabeled specific DNA was added to the reaction before the addition of 1 μM H-NS (lane 4).

Interaction of HlyU and H-NS binding at the region upstream of the rtxA1 operon promoter

To determine the mode of action of HlyU on the antirepressing phenomenon we examined the effect of adding either protein to pre-bound DNA complexes of the other. We first employed competitive gel mobility shift assays between HlyU and H-NS. Fig. 8A shows an H-NS∷DNA complex with significantly retarded mobility formed when H-NS was added to a concentration of 0.7 μM to the DNA fragment. At low concentrations of HlyU (0.01 to 0.09 μM) there was no effect on the existing H-NS∷DNA complex. However, at increasing concentrations of HlyU up to 0.15 μM or above, the mobility was completely altered to the position corresponding to that of the HlyU∷DNA complex without the appearance of any intermediate. In the reverse experiment at a concentration of HlyU of 0.25 μM, increasing concentrations of H-NS up to 0.8 μM did not affect the mobility of the HlyU∷DNA complex (Fig. 8B), however, the addition of H-NS starting at 0.9 μM showed a displacement of HlyU from the DNA and a shift to a predominately H-NS∷DNA complex. These data suggest that HlyU could displace H-NS from the promoter binding at a low concentration and that H-NS needs a much higher concentration to displace the bound HlyU.

Fig. 8.

Fig. 8

Open in a new tab

Competitive mobility shift assay between HlyU and H-NS on the upstream region of the rtxA1 operon promoter. (A) Increasing concentrations of HlyU were added to a fixed concentration of H-NS and DNA (fragment d). (B) Increasing concentrations of H-NS were added to a fixed concentration of HlyU and DNA (fragment d).

To assess whether the HlyU protein would displace the H-NS protein not only from the HlyU binding site but also from all the H-NS binding sites we performed competitive DNase I footprinting assays to examine the change of protection patterns. In reactions between increasing concentrations of HlyU and the H-NS∷DNA complex (at 1.0 μM H-NS), the H-NS protected pattern changed when HlyU was added to a concentration of 0.8μM and higher, with all the H-NS protection sites disappearing, being replaced by the HlyU protection pattern (Fig. 9A, lane 6-8). A lower concentration of HlyU such as 0.2μM did not affect the H-NS protection pattern (Fig. 9A, lane 5). On the reverse reaction, H-NS at a concentration of 0.2 μM added to the HlyU∷DNA complex (at 0.2 μM HlyU) (Fig. 9B, lane 5), did not affect the HlyU protection pattern. At concentrations of H-NS of 0.8 μM and above the HlyU protection pattern was replaced by that corresponding to H-NS (Fig.9B, lane 6-8). These data demonstrate that a low concentration of HlyU can easily affect the binding between the H-NS protein and the upstream region of the rtxA1 operon promoter and replace H-NS in the binding; on the contrary, there is a need for a higher concentration of H-NS to substitute the HlyU protein on this region.

Fig. 9.

Fig. 9

Open in a new tab

Competitive DNase I footprinting assays between HlyU and H-NS on the upstream region of the rtxA1 operon promoter. (A) Increasing concentrations of HlyU and the fixed concentration of H-NS. Lane 1 and 2, no protein; lane 3, HlyU only (0.2 μM); lane 4, H-NS only (1.0 μM); lane 5-8, HlyU (0.2, 0.8, 1.5, 3.0 μM repectively) with the fixed concentration of H-NS (1.0 μM). (B) Increasing concentrations of H-NS and the fixed concentration of HlyU. Lane 1 and 2, no protein; lane 3, H-NS only (1.0 μM); lane 4, HlyU only (0.2 μM); lane 5-8, H-NS (0.2, 0.8, 1.5 and 3.0 μM repectively) with the fixed concentration of HlyU (0.2 μM). Lanes A, C, G and T represent the nucleotide sequencing ladders of pTopo-FP-P20481. Regions protected by H-NS are shown by the black bar, and region protected by HlyU is shown by the open bar.

Discussion

Our laboratory (Liu et al., 2007) and Lee et al. (Lee et al., 2007) demonstrated independently that the RtxA1 toxin, a multifunctional cytotoxin, plays an essential role in the pathogenesis of V. vulnificus infections. It has been reported that the expression of the RtxA1 toxin increased after host cell contact in a time-dependent manner in V. vulnificus (Kim et al., 2008). The RtxA1 toxin induces cytoskeletal rearrangements, plasma membrane blebs and hemolytic activity leading to necrotic cell death (Kim et al., 2008); Lee et al reported that in human intestinal epithelial cells, RtxA induces the death by apoptosis through a mitochondria-dependent pathway (Lee et al., 2008).

In V. vulnificus, as is the case for other pathogens, virulence factors required for in vivo growth must be produced in a tightly regulated manner in the vertebrate host at the right location and the right time during the infection. We determined that an important controlling event in the pathogenesis of V. vulnificus infections is mediated by the regulation of the “repeat in toxin” gene rtxA1 by a global regulator, the HlyU protein (Liu et al., 2007).

Our objective was to dissect the mechanism of HlyU regulation of this important virulence gene. In this work we first demonstrated that HlyU directly binds to the sequence (TGTAATTATTAGTTTTTGTTAAATTAGCATTTTCTTTAAATT) located far upstream of the transcription start site of the rtxA1 operon. This AT-rich sequence has an imperfect palindromic pattern suggesting that HlyU could bind to this region as a dimer. We were surprised to find that progressive deletions of the promoter upstream regions resulted in an increase in the basal transcription of the rtxA1 promoter i. e., the promoter activity of the regulatory region up to 428 bp upstream of the transcription start site became HlyU independent. In order to explain this apparent paradox we needed to revise our ideas with respect to HlyU acting directly as a positive regulator on the rtxA1 promoter and hypothesize that HlyU must operate by relieving the action of a repressor acting at an upstream promoter region. Since the H-NS nucleoid-associated protein is an important global regulator involved in transcriptional silencing of a variety of environmentally responsive genes in many Gram-negative bacteria (Lithgow et al., 2007; Tendeng and Bertin, 2003; Corbett et al., 2007; Chen et al, 2005; Ghosh et al., 2006; Beloin and Dorman, 2003; Banos et al., 2008; Poore and Mobley, 2003; Navarre et al., 2006; Olekhnovich and Kadner, 2007), we decided to evaluate whether it is H-NS that represses the expression of the rtxA1 operon genes. In V. vulnificus CMCP6 there are two H-NS homologues. Only one of them, VV12923 had a phenotype resulting in an increased rtxA1 expression when mutated, suggesting that H-NS must negatively regulate the expression of the rtxA1 operon and that HlyU could act by reverting the H-NS repressing action.

H-NS preferentially binds to AT-rich DNA and usually forms DNA-protein-DNA bridging to impede the movement of RNA polymerase, thus repressing gene expression. The repressive action of H-NS in important bacterial virulence genes is universal having been demonstrated in many bacteria, such as E. coli (Yang et al., 2005; Wyborn et al., 2004; Bustamante et al., 2001; Muller et al., 2006; Lithgow et al., 2007; Juarez et al., 2000; Trachman and Maas, 1998; Corbett et al., 2007), V. cholerae (Nye et al., 2000; Ghosh et al., 2006), Yersinia sp. (Ellison and Miller, 2006; Cathelyn et al., 2007), Salmonella enterica (Olekhnovich and Kadner, 2007; De la Cruz et al., 2007; Walthers et al., 2007), Shigella flexneri (Falconi et al., 1998; Beloin and Dorman, 2003) and others (Poore and Mobley, 2003). Each bacterial system has developed specific approaches to attenuate the H-NS repressive action (Stoebel et al., 2008). Displacement of H-NS from the promoter occurs with the regulators VirB, Ler, UreR, RovA and SlyA at hlyE (Turner and Dorman, 2007; Torres et al, 2007; Poore and Mobley, 2003; Heroven et al, 2004; Westermark et al, 2000); ToxT displaces H-NS and directly activates transcription (Yu et al, 2002). Other mechanisms include modification of the promoter conformation without removing H-NS, as SlyA at pagC (Perez et al, 2008), changes in DNA bending or super-coiling, blocking the polymerization of H-NS along the DNA via promoter-specific DNA-binding proteins such as LeuO (Chen and Wu, 2005), as well as other de-repression mechanisms that are used by weakening the H-NS-DNA complex on the promoter (Williamson and Free, 2005). Our results in this work demonstrate that H-NS binds to multiple regions on the promoter of the rtxA1 operon suggesting that it possibly forms a nucleoprotein complex filament or DNA-H-NS-DNA bridge involving the region extending from far upstream to downstream of the rtxA1 operon promoter impeding the movement of RNA polymerase thus repressing transcription. HlyU only binds to the far upstream region of the promoter, however this binding relieves the H-NS repression at all H-NS binding sites of this region. It is possible that the HlyU binding site might be essential to form the H-NS nucleoprotein complex. Once HlyU binds to this site it destabilizes the whole H-NS nucleoprotein complex resulting in the relief of repression. Alternatively, it is also possible that HlyU binding might block the H-NS polymerization process thus preventing the generation of the nucleoprotein structure, as is the case with LeuO (Chen and Wu, 2005). It remains to be seen which one of these or other possibilities operate in the mechanism of interaction between HlyU, H-NS and DNA. In summary, HlyU in V. vulnificus operates as an antirepressor by displacing H-NS from the upstream promoter region while it does not intervene in the activation of transcription after H-NS is displaced.

Is there a switch or trigger for the HlyU-H-NS partner regulation mechanism? It is known that virulence genes are tightly modulated by environmental factors, for example, H-NS-mediated repression of some promoters is temperature dependent (Falconi et al., 1998). Thus in many bacteria, evolutionary pressures must have favored a mechanism by which control of virulence gene expression can occur by modulating the repressor or the antipressor action. Although the necessity for the H-NS control appears to be ubiquitous in bacteria, in most cases there is no available information on the environmental conditions permitting alternative expression of the two partners in most of the examples in which H-NS has been shown to be involved in the regulation of gene expression. Experiments are currently being carried out to identify the intrinsic environmental and in vivo conditions for the HlyU antirepressing mechanism against the H-NS action on the regulation of rtxA1 expression in V. vulnificus.

Experimental procedure

Bacterial strains, plasmids, and primers

The strains and plasmids used in this work are listed on Table 3, whereas all primers used are listed in Table 4. Bacteria were grown in LB broth (Escherichia coli) or trypticase soy broth (V. vulnificus) with 1.5% NaCl (TSBS) supplemented with antibiotics as appropriate. When needed, 1.5% agar was added. For E. coli, antibiotics were 100 μg/ml ampicillin, 30 μg/ml chloramphenicol and 50 μg/ml kanamycin. For V. vulnificus, antibiotics were 2 μg/ml chloramphenicol, 400 μg/ml kanamycin and 500 μg/ml ampicillin. All plasmids to be conjugated into V. vulnificus were first transformed into E. coli S17-1 (λpir), which was used as the donor strain. Conjugations from E. coli to V. vulnificus were carried out by bi-parental mating (Park et al., 2004).

Table 3.

Bacterial strains and plasmids used in this study

Strain or plasmid Relevant characteristicsa Source or reference
V. vulnificus
CMCP6 Clinical isolate Kim et al. (2003)
ALE-LAC ΔlacZ Liu et al. (2007)
MQ4 ΔlacZ ΔhlyU Liu et al. (2007)
MQ5 ΔlacZ hns∷pDM4 This study
MQ6 ΔlacZ ΔhlyU hns∷pDM4 This study
hns restore strain The suicide plasmid pDM4 is cured from MQ5 This study
E. coli
Top 10 F- mcrA Δ(mrr-hsdRMS-mcrBC) Φ80lacZΔM15 ΔlacX74 recA1 araD139 Δ(ara-leu)7697 galU galK rpsL (StrR) endA1 nupG Invitrogen
S17-1λpir λ-pir lysogen; thi pro hsdR hsdM+recA RP4 2-Tc∷Mu-Km∷Tn7(Tpr Smr) Simon (1983)
BL21 Star™ (DE3) F− ompT hsd SB(rB− mB−) gal dcm rne131 (DE3) Novagen
Plasmids
pCR2.1 Vector for general cloning and blue/white screening without IPTG, Apr, Kmr Invitrogen
pET101/D-TOPO Protein expression vector with C-terminal His6 tag, Apr Invitrogen
pDM4 Suicide vector with ori R6K sacB, Cmr Milton et al. (1996)
pTL61T A pBR322 derivative containing promoterless lacZ gene used for transcriptional gene fusion studies, Apr Linn and St Pierre, (1990)
pMMB208K pMMB208 derivative in which the chloramphenicol gene was replaced by the kanamycin gene in DraI sites, Kmr This study
pCR-FP-template pCR2.1 derivative containing a 264bp of rtxA1 promoter region with PstI and XhoI on either side. This study
pTL-523 pTL61T derivative containing a fragment extending from -523 bp to + 279 bp of the transcript start site of rtxA1 operon promoter. This study
pTL-428 pTL61T derivative containing a fragment extending from -428 bp to + 279 bp of the transcript start site of rtxA1 operon promoter. This study
pTL-347 pTL61T derivative containing a fragment extending from -347 bp to + 279 bp of the transcript start site of rtxA1 operon promoter. This study
pTL-278 pTL61T derivative containing a fragment extending from -278 bp to + 279 bp of the transcript start site of rtxA1 operon promoter. This study
pTL-35 pTL61T derivative containing a fragment extending from -35 bp to + 279 bp of the transcript start site of rtxA1 operon promoter. This study
pCR-hns pCR2.1 derevative containing an internal VV12923 (hns) fragment This study
pDM-hns pDM4 derivative containing an internal VV12923 (hns) fragment This study
pET-hns pET101/D derivative containing the hns gene, Apr This study
pMMB-hlyU pMMB208K derevative containing the hlyU gene and its SB site, Kmr This study
Open in a new tab
a

Tpr, trimethoprim resistant; Smr, stremptomycin resistant; Apr, ampicillin resistant; Cmr, chloramphenicol resistant; Kmr, kanamycin resistant; SD, Shine-Dalgarno.

Table 4.

Oligonucleotides used in this studya

Primers Sequence (5’-3’) Objective
Footprint-T-R CTGCAGCCTTCAAAAACGCTGCAAT (PstI) Footprinting
P20481-F750 CTCGAGTCAAATAAAATGGCGGGTGT (XhoI) Footprinting; lacZ fusion; RPA; Gel shift (probe d)
Footprint-T AATTCGCCCTTCTGCAGCCT Footprinting
Footprint-NonT AATTCGCCCTTCTCGAGTCA Footprinting
P20481-R CTGCAGACTTGCTTAAGTTCAAGATC (PstI) RLM-RACE; lacZ fusion; Gel shift (probe a)
RACE20481-R-in GTTTGAACAAACTTCTCAGTC RLM-RACE
5’ RACE outer primer GCTGATGGCGATGAATGAACACTG RLM-RACE
P20481RPA-894 R TAATACGACTCACTATAGGCTTAAAAGGAATCACTCTCC RPA
P20481RPA-1053F GAATAATTGCTCTAATATAATCG RPA
P20481RPA-1083R TAATACGACTCACTATAGGCCATATTCATGTAACAATCAC RPA
P20481RPA-1343R TAATACGACTCACTATAGGCAGCGGTAATAGAGAACAAT RPA
GELS1-F AAAGGAACAATTTTCGTC Gel shift (probe a)
GELS2-F ACCACTGTTTTACGATGTAA Gel shift (probe b)
GELS2-R GATAAGACGAAAATTGTTCC Gel shift (probe b)
GELS3-F TATTGCAGCGTTTTTGAAGG Gel shift (probe c)
GELS3-R CATCAATAGACTTAAATCG Gel shift (probe c)
GELS4-R CCTTCAAAAACGCTGCAAT Gel shift (probe d)
P20481-F300 CTCGAGTTGATGACCACTGTTTTACG (XhoI) lacZ fusion
P20481-F550 CTCGAGATTGCAGCGTTTTTGAAGG (XhoI) lacZ fusion; RPA
P20481-F574 CTCGAGATAAAAGTGAATACATATCAGC (XhoI) lacZ fusion
P20481-F655 CTCGAGGAGTTCATCTTTGTAATTATTAG (XhoI) lacZ fusion
VV12923- F CAACTGTTGTTGCAGAGC Contruction of hns mutant
VV12923- R CAACGTACTTGTATTTCGC Contruction of hns mutant
VV12923-C-F CACCATGTCTGAACTAACAAAAACTC Construction of H-NS expression plasmid
VV12923-C-R TTAGATTTCGAAATCTTCTAGAG Construction of H-NS expression plasmid
VV20481-F ATGGCGAATGGCGTAATGG Real time RT-PCR
VV20481-R TGGGAAGTGCGTTTTTTCG Real time RT-PCR
rtxA1-F CCCTGATGGTAATACCCCGTT Real time RT-PCR
rtxA1-R TTAGCCCACTGACTCGATTCCT Real time RT-PCR
g3P-F CGTATTCTGCACCTTTCCGAAA Real time RT-PCR
g3P-R CTGGATGCGAAAACAGCACTTT Real time RT-PCR
HlyU-comp-F GGATCCTATCTGCAACAACCGTTGG (BamHI) Contruction of HlyU expression plasmid
HlyU-comp-R GTCGACCTTTTCTACACGGCACGCA (SalI) Contruction of HlyU expression plasmid
Open in a new tab
a

Restriction sites are shown in italics, and the restriction enzyme used in the primer is marked.

DNA manipulations and sequence analysis

Plasmid DNA was prepared by using a Qiaprep miniprep kit (Qiagen). DNA digestion and ligation were performed according to the manufacture’s instruction (New England Biolab Inc.). PCR were carried out using a Mycycler™ Thermal Cycler as specified by the manufacture (Bio-Rad Laboratories INC.,). PCR products were purified by Qiaquick PCR purification kit or Qiaquick gel extraction kit (Qiagen). DNA sequencing reactions were carried out by the Oregon Health and Science University MMI Research Core Facility.

RNA purification

V. vulnificus stains were grown to OD600 = 0.5-0.8 in TSBS. Total RNA was purified using the RNAWiz reagent (Ambion) according to the manufacturer’s instructions, and then treated with TURBO DNA-free DNase (Ambion) at 37°C for 30 minutes to remove the residual genomic DNA.

RLM-RACE

The modified RLM-RACE (Bensing et al., 1996) was performed to determine the transcription start point of the rtxA1 operon by using FirstChoice RLM-RACE kit (Ambion). 10 μg total RNA extracted from V. vulnificus CMCP6 was treated with tobacco acid pyrophosphatase (TAP) and ligated 5’ RNA adaptor to the 5’-terminal ends, while a TAP-untreated control sample was generated by replacing the TAP with nuclease-free water. 2 μl of the adapter-ligated RNA was used in the reverse transcription with primer P20481-R and superscript II reverse transcriptase (Invitrogen). The cDNA was then used as a template in a PCR with a gene specific primer RACE20481-R-in combined with an adapter-specific 5’ RACE outer primer. PCR products were separated by agarose gel electrophoresis, and subsequently the fragments obtained from the TAP-treated and TAP-untreated samples were purified by a gel purification kit (Qiagen), cloned into pCR2.1®-TOPO vector (Invitrogen), then at least 5 clones from each fragment were sequenced.

Ribonuclease protection assay (RPA)

The probe fragments a’, b’ and c’ were amplified by using primer pairs P20481RPA-894R and P20481RPA-1053F, P20481RPA-1083R and P20481-F550 as well as P20481RPA-1343R and P20481-F750, respectively, to make 150~200 nt of DNA templates. All reverse primers used in above reactions were designed to contain a recognition sequence for T7 polymerase (TAATACGACTCACTATAGGC). RNA probes were synthesized and labeled with [α-32P] UTP by using MAXIscript Kit (Ambion) according to the manufacture’s instruction. RPA experiments were conducted using the RPAIII Ribonuclease Protection Assay Kit (Ambion). The total RNAs from V. vulnificus CMCP6 were incubated with the indicated probes overnight at 42 °C, treated with a mixture of RNAse A and RNAse T1 for 30 minutes at 37 °C, precipitated and resuspended in gel loading buffer II. The labeled RNAs were electrophoresed in urea-6% polyacrylamide gels that were then exposed for 4 to 24 h.

β-galactosidase assay

V. vulnificus strains were grown overnight at 37°C in TSBS with the appropriate antibiotics. Cell cultures were diluted at 1:100 into the same media and further incubated at 37°C with shaking. 0.1 ml aliquots were withdrawn at various time points, and β-galactosidase assays were performed according to the Miller’s method (Miller, 1992).

Construction of a V. vulnificus hns insertion mutant

An internal fragment of the hns gene (VV12923) was amplified by using primers VV12923-F and VV12923-R. This fragment was cloned into pCR2.1, sequenced and then sub-cloned into the suicide vector pDM4, generating pDM-hns. Insertion of the whole suicide vector into the chromosome by a single crossover generated the hns disruptant MQ5. Since the gene downstream of hns has different transcription direction, this insertion does not cause a polar effect.

Real time RT-PCR

2 μg total RNA was used in the reverse transcription (RT) reaction with the random primer (Invitrogen) using Superscript II reverse transcriptase (Invitrogen) according to the manufacturer’s instructions. The amplifications were performed in 96-well plates using a 25 μl total reaction volume containing 12.5 μl of SYBR® Green PCR Master Mix (Applied Biosystems), the appropriate amount of forward and reverse primers (the final concentration for each primer is 200 nM), and 8 μl of 1:10 diluted cDNA from each reverse transcription reaction as a template. The following condition was used for the PCR reaction: 1 cycle for 5 min at 50°C and 40 cycles of denaturation at 95°C for 30 sec, annealing at 58°C for 1 min, and extension for 30 sec at 72°C. Each reaction was performed in triplicate. The RT reaction without the reverse transcriptase enzyme was used as a negative control for each gene. The gene encoding glyceraldehyde 3-phosphate dehydrogenase (gap) was used as an internal control. Each experiment was carried out three times. The relative fold change was calculated using the Delta-Delta CT approximation method, where CT is the threshold cycle.

Overexpression and purification of the V. vulnificus H-NS protein

The DNA fragment encoding H-NS was amplified with the primers VV12923-C-F and VV12923-C-R and cloned into a His-tag expression plasmid pET101/D-TOPO, generating the plasmid pET101-hns that encodes H-NS with a C-terminal fusion tag. The recombinant clone, after confirmation by sequencing, was used for expression of H-NS-His protein in E. coli BL21 (DE3) star. Purification of this protein by affinity chromatography was carried out as described before (Liu et al., 2007).

Gel mobility shift assay

Gel mobility shift assays were performed using a digoxigenin gel shift kit (second generation; Roche). The probe fragments were amplified by PCR and then 3’ end labeled with digoxigenin-11-ddUTP using terminal transferase. In a 20 μl reaction volume, 5 nM labeled probe was incubated at room temperature for 20 minutes with various amount of H-NS-His protein plus 0.2 μg poly[d(A-T)] and 0.1 μg polyL-lysine in the binding buffer [100 mM HEPES, pH7.6, 5 mM EDTA, 50 mM (NH4)2SO4, 5 mM dithiothreitol, 1% (wt/vol) Tween 20, 150 mM KCl]. After addition of 2 μl loading buffer, the reactions were separated by 6% DNA retardation gel (Invitrogen). The DNA-protein complex was transferred to positively charged nylon membrane by electroblotting, then immunological detection and chemiluminescent signal detection were carried out according to the manufacture’s instruction (Roche).

DNase I Footprinting

The promoter fragment amplified by primers P20481-F750 and Footprint-T-R was ligated into pCR2.1, generating plasmid pCR-FP-template. Subsequently plasmid DNA was digested with EcoRI, a 294-bp fragment was gel purified and treated with alkaline phosphatase to remove the 5’-terminal phosphate groups and then labeled at both ends using T4 polynucleotide kinase. The coding strand was obtained by digesting the label off one end with XhoI. Binding reactions were carried out using the Core Footprinting System from Promega. The promoter-containing DNA fragment (50,000cpm) at a final concentration of 5 nM was incubated with different amounts of purified HlyU-His (or H-NS-His) protein in 20 μl of reaction buffer [100 mM Hepes, pH7.6, 5 mM EDTA, 50 mM (NH4)2SO4, 5 mM DTT, Tween 20, 1%(w/v), 150 mM KCl]. After 20 min at room temperature, 20 μl of Ca2+/Mg2+ solution was added and incubated for 1 min, then DNase I digestion was started by the addition of 0.09 unit DNase. After 1 min at room temperature, 40 μl of stop solution was added. The DNA was precipitated with 100% ethanol, air-dried and dissolved in a loading buffer, and resolved by electrophoresis on 6% sequencing gel. The sequencing of the fragment was generated by Sequenase Quick-Denature sequencing kit (USB Corporation) on the same DNA fragment. The gel was dried and exposed on the BioMax film (Kodak).

Acknowledgments

This work was supported by grants AI065981 and AI19018 from the National Institutes of Health to J.H.C.

References

  1. Alice AF, Naka H, Crosa JH. Global gene expression as a function of the iron status of the bacterial cell: influence of differentially expressed genes in the virulence of the human pathogen Vibrio vulnificus. Infect Immun. 2008;76:4019–4037. doi: 10.1128/IAI.00208-08. [DOI] [PMC free article] [PubMed] [Google Scholar]
  2. Amaro C, Biosca EG, Fouz B, Alcaide E, Esteve C. Evidence that water transmits Vibrio vulnificus biotype 2 infections to eels. Appl Environ Microbiol. 1995;61:1133–1137. doi: 10.1128/aem.61.3.1133-1137.1995. [DOI] [PMC free article] [PubMed] [Google Scholar]
  3. Banos RC, Pons JI, Madrid C, Juarez A. A global modulatory role for the Yersinia enterocolitica H-NS protein. Microbiology. 2008;154:1281–1289. doi: 10.1099/mic.0.2007/015610-0. [DOI] [PubMed] [Google Scholar]
  4. Beloin C, Dorman CJ. An extended role for the nucleoid structuring protein H-NS in the virulence gene regulatory cascade of Shigella flexneri. Mol Microbiol. 2003;47:825–838. doi: 10.1046/j.1365-2958.2003.03347.x. [DOI] [PubMed] [Google Scholar]
  5. Bensing BA, Meyer BJ, Dunny GM. Sensitive detection of bacterial transcription initiation sites and differentiation from RNA processing sites in the pheromone-induced plasmid transfer system of Enterococcus faecalis. Proc Natl Acad Sci U S A. 1996;93:7794–7799. doi: 10.1073/pnas.93.15.7794. [DOI] [PMC free article] [PubMed] [Google Scholar]
  6. Brown RN, Gulig PA. Regulation of fatty acid metabolism by FadR is essential for Vibrio vulnificus to cause infection of mice. J Bacteriol. 2008;190:7633–7644. doi: 10.1128/JB.01016-08. [DOI] [PMC free article] [PubMed] [Google Scholar]
  7. Bustamante VH, Santana FJ, Calva E, Puente JL. Transcriptional regulation of type III secretion genes in enteropathogenic Escherichia coli: Ler antagonizes H-NS-dependent repression. Mol Microbiol. 2001;39:664–678. doi: 10.1046/j.1365-2958.2001.02209.x. [DOI] [PubMed] [Google Scholar]
  8. Cathelyn JS, Ellison DW, Hinchliffe SJ, Wren BW, Miller VL. The RovA regulons of Yersinia enterocolitica and Yersinia pestis are distinct: evidence that many RovA-regulated genes were acquired more recently than the core genome. Mol Microbiol. 2007;66:189–205. doi: 10.1111/j.1365-2958.2007.05907.x. [DOI] [PubMed] [Google Scholar]
  9. Chen YC, Chang MC, Chuang YC, Jeang CL. Characterization and virulence of hemolysin III from Vibrio vulnificus. Curr Microbiol. 2004;49:175–179. doi: 10.1007/s00284-004-4288-5. [DOI] [PubMed] [Google Scholar]
  10. Chen CC, Wu HY. LeuO protein delimits the transcriptionally active and repressive domains on the bacterial chromosome. J Biol Chem. 2005;280:15111–15121. doi: 10.1074/jbc.M414544200. [DOI] [PubMed] [Google Scholar]
  11. Chiang SR, Chuang YC. Vibrio vulnificus infection: clinical manifestations, pathogenesis, and antimicrobial therapy. J Microbiol Immunol Infect. 2003;36:81–88. [PubMed] [Google Scholar]
  12. Corbett D, Bennett HJ, Askar H, Green J, Roberts IS. SlyA and H-NS regulate transcription of the Escherichia coli K5 capsule gene cluster, and expression of slyA in Escherichia coli is temperature-dependent, positively autoregulated, and independent of H-NS. J Biol Chem. 2007;282:33326–33335. doi: 10.1074/jbc.M703465200. [DOI] [PubMed] [Google Scholar]
  13. De la Cruz MA, Fernandez-Mora M, Guadarrama C, Flores-Valdez MA, Bustamante VH, Vazquez A, Calva E. LeuO antagonizes H-NS and StpA-dependent repression in Salmonella enterica ompS1. Mol Microbiol. 2007;66:727–743. doi: 10.1111/j.1365-2958.2007.05958.x. [DOI] [PubMed] [Google Scholar]
  14. Ellison DW, Miller VL. H-NS represses inv transcription in Yersinia enterocolitica through competition with RovA and interaction with YmoA. J Bacteriol. 2006;188:5101–5112. doi: 10.1128/JB.00862-05. [DOI] [PMC free article] [PubMed] [Google Scholar]
  15. Falconi M, Colonna B, Prosseda G, Micheli G, Gualerzi CO. Thermoregulation of Shigella and Escherichia coli EIEC pathogenicity. A temperature-dependent structural transition of DNA modulates accessibility of virF promoter to transcriptional repressor H-NS. EMBO J. 1998;17:7033–7043. doi: 10.1093/emboj/17.23.7033. [DOI] [PMC free article] [PubMed] [Google Scholar]
  16. Ghosh A, Paul K, Chowdhury R. Role of the histone-like nucleoid structuring protein in colonization, motility, and bile-dependent repression of virulence gene expression in Vibrio cholerae. Infect Immun. 2006;74:3060–3064. doi: 10.1128/IAI.74.5.3060-3064.2006. [DOI] [PMC free article] [PubMed] [Google Scholar]
  17. Hlady WG, Klontz KC. The epidemiology of Vibrio infections in Florida, 1981-1993. J Infect Dis. 1996;173:1176–1183. doi: 10.1093/infdis/173.5.1176. [DOI] [PubMed] [Google Scholar]
  18. Heroven AK, Nagel G, Tran HJ, Parr S, Dersch P. RovA is autoregulated and antagonizes H-NS-mediated silencing of invasin and rovA expression in Yersinia pseudotuberculosis. Mol Micriobiol. 2004;53:871–888. doi: 10.1111/j.1365-2958.2004.04162.x. [DOI] [PubMed] [Google Scholar]
  19. Juarez A, Nieto JM, Prenafeta A, Miquelay E, Balsalobre C, Carrascal M, Madrid C. Interaction of the nucleoid-associated proteins Hha and H-NS to modulate expression of the hemolysin operon in Escherichia coli. Adv Exp Med Biol. 2000;485:127–131. doi: 10.1007/0-306-46840-9_17. [DOI] [PubMed] [Google Scholar]
  20. Kim YR, Lee SE, Kim CM, Kim SY, Shin EK, Shin DH, et al. Characterization and pathogenic significance of Vibrio vulnificus antigens preferentially expressed in septicemic patients. Infect Immun. 2003;71:5461–5471. doi: 10.1128/IAI.71.10.5461-5471.2003. [DOI] [PMC free article] [PubMed] [Google Scholar]
  21. Kim YR, Lee SE, Kook H, Yeom JA, Na HS, Kim SY, et al. Vibrio vulnificus RTX toxin kills host cells only after contact of the bacteria with host cells. Cell Microbiol. 2008;10:848–862. doi: 10.1111/j.1462-5822.2007.01088.x. [DOI] [PubMed] [Google Scholar]
  22. Kim YR, Rhee JH. Flagellar basal body flg operon as a virulence determinant of Vibrio vulnificus. Biochem Biophys Res Commun. 2003;304:405–410. doi: 10.1016/s0006-291x(03)00613-2. [DOI] [PubMed] [Google Scholar]
  23. Kothary MH, Kreger AS. Purification and characterization of an elastolytic protease of Vibrio vulnificus. J Gen Microbiol. 1987;133:1783–1791. doi: 10.1099/00221287-133-7-1783. [DOI] [PubMed] [Google Scholar]
  24. Lee BC, Choi SH, Kim TS. Vibrio vulnificus RTX toxin plays an important role in the apoptotic death of human intestinal epithelial cells exposed to Vibrio vulnificus. Microbes Infect. 2008;10:1504–1513. doi: 10.1016/j.micinf.2008.09.006. [DOI] [PubMed] [Google Scholar]
  25. Lee JH, Kim MW, Kim BS, Kim SM, Lee BC, Kim TS, Choi SH. Identification and characterization of the Vibrio vulnificus rtxA essential for cytotoxicity in vitro and virulence in mice. J Microbiol. 2007;45:146–152. [PubMed] [Google Scholar]
  26. Lee JH, Rho JB, Park KJ, Kim CB, Han YS, Choi SH, et al. Role of flagellum and motility in pathogenesis of Vibrio vulnificus. Infect Immun. 2004;72:4905–4910. doi: 10.1128/IAI.72.8.4905-4910.2004. [DOI] [PMC free article] [PubMed] [Google Scholar]
  27. Lee SE, Shin SH, Kim SY, Kim YR, Shin DH, Chung SS, et al. Vibrio vulnificus has the transmembrane transcription activator ToxRS stimulating the expression of the hemolysin gene vvhA. J Bacteriol. 2000;182:3405–3415. doi: 10.1128/jb.182.12.3405-3415.2000. [DOI] [PMC free article] [PubMed] [Google Scholar]
  28. Linkous DA, Oliver JD. Pathogenesis of Vibrio vulnificus. FEMS Microbiol Lett. 1999;174:207–214. doi: 10.1111/j.1574-6968.1999.tb13570.x. [DOI] [PubMed] [Google Scholar]
  29. Linn T, St Pierre R. Improved vector system for constructing transcriptional fusions that ensures independent translation of lacZ. J Bacteriol. 1990;172:1077–1084. doi: 10.1128/jb.172.2.1077-1084.1990. [DOI] [PMC free article] [PubMed] [Google Scholar]
  30. Lithgow JK, Haider F, Roberts IS, Green J. Alternate SlyA and H-NS nucleoprotein complexes control hlyE expression in Escherichia coli K-12. Mol Microbiol. 2007;66:685–698. doi: 10.1111/j.1365-2958.2007.05950.x. [DOI] [PMC free article] [PubMed] [Google Scholar]
  31. Litwin CM, Rayback TW, Skinner J. Role of catechol siderophore synthesis in Vibrio vulnificus virulence. Infect Immun. 1996;64:2834–2838. doi: 10.1128/iai.64.7.2834-2838.1996. [DOI] [PMC free article] [PubMed] [Google Scholar]
  32. Liu M, Alice AF, Naka H, Crosa JH. The HlyU protein is a positive regulator of rtxA1, a gene responsible for cytotoxicity and virulence in the human pathogen Vibrio vulnificus. Infect Immun. 2007;75:3282–3289. doi: 10.1128/IAI.00045-07. [DOI] [PMC free article] [PubMed] [Google Scholar]
  33. Miller JH. A short course in bacterial genetics. Cold Spring Harbor Laboratory Press; Cold Spring Harbor, NY: 1992. [Google Scholar]
  34. Milton DL, O’Toole R, Horstedt P, Wolf-Watz H. Flagellin A is essential for the virulence of Vibrio anguillarum. J Bacteriol. 1996;178:1310–1319. doi: 10.1128/jb.178.5.1310-1319.1996. [DOI] [PMC free article] [PubMed] [Google Scholar]
  35. Morris JGJ. Vibrio vulnificus--a new monster of the deep? Ann Intern Med. 1988;109:261–263. doi: 10.7326/0003-4819-109-4-261. [DOI] [PubMed] [Google Scholar]
  36. Muller CM, et al. Role of histone-like proteins H-NS and StpA in expression of virulence determinants of uropathogenic Escherichia coli. J Bacteriol. 2006;188:5428–5438. doi: 10.1128/JB.01956-05. [DOI] [PMC free article] [PubMed] [Google Scholar]
  37. Navarre WW, Porwollik S, Wang Y, McClelland M, Rosen H, Libby SJ, Fang FC. Selective silencing of foreign DNA with low GC content by the H-NS protein in Salmonella. Science. 2006;313:236–238. doi: 10.1126/science.1128794. [DOI] [PubMed] [Google Scholar]
  38. Nye MB, Pfau JD, Skorupski K, Taylor RK. Vibrio cholerae H-NS silences virulence gene expression at multiple steps in the ToxR regulatory cascade. J Bacteriol. 2000;182:4295–4303. doi: 10.1128/jb.182.15.4295-4303.2000. [DOI] [PMC free article] [PubMed] [Google Scholar]
  39. Olekhnovich IN, Kadner RJ. Role of nucleoid-associated proteins Hha and H-NS in expression of Salmonella enterica activators HilD, HilC, and RtsA required for cell invasion. J Bacteriol. 2007;189:6882–6890. doi: 10.1128/JB.00905-07. [DOI] [PMC free article] [PubMed] [Google Scholar]
  40. Paranjpye RN, Johnson AB, Baxter AE, Strom MS. Role of type IV pilins in persistence of Vibrio vulnificus in Crassostrea virginica oysters. Appl Environ Microbiol. 2007;73:5041–5044. doi: 10.1128/AEM.00641-07. [DOI] [PMC free article] [PubMed] [Google Scholar]
  41. Paranjpye RN, Strom MS. A Vibrio vulnificus type IV pilin contributes to biofilm formation, adherence to epithelial cells, and virulence. Infect Immun. 2005;73:1411–1422. doi: 10.1128/IAI.73.3.1411-1422.2005. [DOI] [PMC free article] [PubMed] [Google Scholar]
  42. Park KJ, Kang MJ, Kim SH, Lee HJ, Lim JK, Choi SH, et al. Isolation and characterization of rpoS from a pathogenic bacterium, Vibrio vulnificus: role of sigmaS in survival of exponential-phase cells under oxidative stress. J Bacteriol. 2004;186:3304–3312. doi: 10.1128/JB.186.11.3304-3312.2004. [DOI] [PMC free article] [PubMed] [Google Scholar]
  43. Perez JC, Larifi T, Groisman EA. Overcoming H-NS-mediated transcriptional slilencing of horizontally acquired genes by the PhoP and SlyA proteins in Salmonella enterica. J Biol Chem. 2008;283:10773–10783. doi: 10.1074/jbc.M709843200. [DOI] [PMC free article] [PubMed] [Google Scholar]
  44. Poore CA, Mobley HL. Differential regulation of the Proteus mirabilis urease gene cluster by UreR and H-NS. Microbiology. 2003;149:3383–3394. doi: 10.1099/mic.0.26624-0. [DOI] [PubMed] [Google Scholar]
  45. Potasman I, Paz A, Odeh M. Infectious outbreaks associated with bivalve shellfish consumption: a worldwide perspective. Clin Infect Dis. 2002;35:921–928. doi: 10.1086/342330. [DOI] [PubMed] [Google Scholar]
  46. Saha RP, Basu G, Chakrabarti P. Cloning, expression, purification, and characterization of Vibrio cholerae transcriptional activator, HlyU. Protein Expr Purif. 2006;48:118–125. doi: 10.1016/j.pep.2006.02.008. [DOI] [PubMed] [Google Scholar]
  47. Saha RP, Chakrabarti P. Molecular modeling and characterization of Vibrio cholerae transcription regulator HlyU. BMC Struct Biol. 2006;6:24. doi: 10.1186/1472-6807-6-24. [DOI] [PMC free article] [PubMed] [Google Scholar]
  48. Simon R, Priefer U, Puhler A. A broad host range mobilization system for in vivo genetic engineering transposon mutagenesis in gram-negative bacteria. Bio/Technology. 1983;1:787–796. [Google Scholar]
  49. Smith AB, Siebeling RJ. Identification of genetic loci required for capsular expression in Vibrio vulnificus. Infect Immun. 2003;71:1091–1097. doi: 10.1128/IAI.71.3.1091-1097.2003. [DOI] [PMC free article] [PubMed] [Google Scholar]
  50. Stoebel DM, Free A, Dorman CJ. Anti-silencing: overcoming H-NS-mediated repression of transcription in Gram-negative enteric bacteria. Microbiology. 2008;154:2533–2545. doi: 10.1099/mic.0.2008/020693-0. [DOI] [PubMed] [Google Scholar]
  51. Strom MS, Paranjpye RN. Epidemiology and pathogenesis of Vibrio vulnificus. Microbes Infect. 2000;2:177–188. doi: 10.1016/s1286-4579(00)00270-7. [DOI] [PubMed] [Google Scholar]
  52. Tendeng C, Bertin PN. H-NS in Gram-negative bacteria: a family of multifaceted proteins. Trends Microbiol. 2003;11:511–518. doi: 10.1016/j.tim.2003.09.005. [DOI] [PubMed] [Google Scholar]
  53. Torres AG, Lopez-Sanchez GN, Milflores-Flores L, Patel SD, Rojas-Lopez M, Martinez de la Pena CF, et al. Ler and H-NS, regulators controlling expression of the long polar fimbriae of Escherichia coli O157:H7. J Bacteriol. 2007;189:5916–5928. doi: 10.1128/JB.00245-07. [DOI] [PMC free article] [PubMed] [Google Scholar]
  54. Trachman JD, Maas WK. Temperature regulation of heat-labile enterotoxin (LT) synthesis in Escherichia coli is mediated by an interaction of H-NS protein with the LT A-subunit DNA. J Bacteriol. 1998;180:3715–3718. doi: 10.1128/jb.180.14.3715-3718.1998. [DOI] [PMC free article] [PubMed] [Google Scholar]
  55. Turner EC, Dorman CJ. H-NS antagonism in Shigella flexneri by VirB, a virulence gene transcription regulator that is closely related to plasmid partition factors. J Bacteriaiol. 2007;189:3403–3413. doi: 10.1128/JB.01813-06. [DOI] [PMC free article] [PubMed] [Google Scholar]
  56. Walthers D, Carroll RK, Navarre WW, Libby SJ, Fang FC, Kenney LJ. The response regulator SsrB activates expression of diverse Salmonella pathogenicity island 2 promoters and counters silencing by the nucleoid-associated protein H-NS. Mol Microbiol. 2007;65:477–493. doi: 10.1111/j.1365-2958.2007.05800.x. [DOI] [PubMed] [Google Scholar]
  57. Westermark M, Oscarsson J, Mizunoe Y, Urbonaviciene J, Uhlin BE. Silencing and activation of ClyA cytotoxin expression in Escherichia coli. J Bacteriol. 2000;182:6347–6357. doi: 10.1128/jb.182.22.6347-6357.2000. [DOI] [PMC free article] [PubMed] [Google Scholar]
  58. Williams SG, Attridge SR, Manning PA. The transcriptional activator HlyU of Vibrio cholerae: nucleotide sequence and role in virulence gene expression. Mol Microbiol. 1993;9:751–760. doi: 10.1111/j.1365-2958.1993.tb01735.x. [DOI] [PubMed] [Google Scholar]
  59. Williamson HS, Free A. A truncated H-NS-like protein from enteropathogenic Escherichia coli acts as an H-NS antagonist. Mol Microbiol. 2005;55:808–827. doi: 10.1111/j.1365-2958.2004.04421.x. [DOI] [PubMed] [Google Scholar]
  60. Wright AC, Powell JL, Tanner MK, Ensor LA, Karpas AB, Morris JG, JR, Sztein MB. Differential expression of Vibrio vulnificus capsular polysaccharide. Infect Immun. 1999;67:2250–2257. doi: 10.1128/iai.67.5.2250-2257.1999. [DOI] [PMC free article] [PubMed] [Google Scholar]
  61. Wyborn NR, Stapleton MR, Norte VA, Roberts RE, Grafton J, Green J. Regulation of Escherichia coli hemolysin E expression by H-NS and Salmonella SlyA. J Bacteriol. 2004;186:1620–1628. doi: 10.1128/JB.186.6.1620-1628.2004. [DOI] [PMC free article] [PubMed] [Google Scholar]
  62. Yang J, Tauschek M, Strugnell R, Robins-Browne RM. The H-NS protein represses transcription of the eltAB operon, which encodes heat-labile enterotoxin in enterotoxigenic Escherichia coli, by binding to regions downstream of the promoter. Microbiology. 2005;151:1199–1208. doi: 10.1099/mic.0.27734-0. [DOI] [PubMed] [Google Scholar]
  63. Yu RR, DiRita VJ. Regulation of gene expression in Vibrio cholerae by ToxT involves both antirepression and RNA polymerase stimulation. Mol Microbiol. 2002;43:119–134. doi: 10.1046/j.1365-2958.2002.02721.x. [DOI] [PubMed] [Google Scholar]

RESOURCES