Table 1.
Nucleotide sequences of RT primers, PCR primers, and molecular beacons for bacterial gene expression measurements.
| Gene | RT primers | PCR primers | Molecular beacons |
|---|---|---|---|
| katG (Rv1908) | tgacctcccacccgacttgtg | catgggtcccgttgcgagata cccggatctggctcttaaggc |
FAMagcgcgatccggtccctgcg gtcagcgcgctDabcyl |
| glbN (Rv1542c) | caggctgaagtggtgcatggtaa | caaacgtgagccgatcagcat cggcaagcacacgaacataga |
FAMccgcggcatgaggccatcga agtcgtcgcggDabcyl |
| ahpC (Rv2428) | tgttggggtcgacgataaaggtc | ggcgttcagcaagctcaatgac agcatcgggaagggtaacgtttt |
FAMccggcggcccagatcctggg ggtttcgcgccggDabcyl |
| trxB2 (Rv3913) | tcagcggcccgtgaagtgatac | ctggtcttcgagggcacgtct cccgcatctcatccatcaactc |
FAMacgcgcgacgtggagaacta cccgggagcgcgtDabcyl |
| msrA (Rv0137c) | tggggtagcgctgcaggtagt | cttccagatccacgacccgacaac gatccgcttttgctgctcatcgaa |
FAMgcgcgaacgaccggggga ccagctaccgcgcDabcyl |
| hmp (Rv3571) | gatccgattccagcgacttgaa | ctcgttgtgcagttcgccctac gagggttgtggggacgaagtt |
FAMcgggccaccgccgacgggt acgcctcggcccgDabcyl |
Nucleotide sequences were obtained from http://genolist.pasteur.fr/TubercuList/48. RT and PCR primers (direction: 5′ to 3′, one primer per line) were designed by using the software Oligo 6.6 (Molecular Biology Insights, Cascade, CO) and were purchased from Integrated DNA Technologies (Coralville, Iowa). Molecular beacons were synthesized by Biosearch Technologies (Novato, CA). The nucleotide sequences of primers and molecular beacons for M. tuberculosis 16S rRNA, sodA and sodC were published previously 22. FAM, iodoacetamide derivative of fluorescein (5-iodoactamidofluorescein); Dabcyl, 4-(4′-dimethylaminophenylazo)-benzoic acid) succinimidyl ester.