TABLE 5.
Alleles of HAdV MicrosatV identified in GenBanka
| Accession no. | Serotype (species) | Microsatellite sequence | Allele (including extensions) |
|---|---|---|---|
| AY599837 | 4 (E) | GGTCCAAAAAAAAAAAAAGCTAG | A(13) |
| AY599835 | 4 (E) | GGTCCAAAAAAAAAAGCTAG | A(10) |
| HAU10681 | 4 (E) | GGTCCAAAAAAAAGCTAG | A(8) |
| AY594253 | 4 (E) | GGTCGAAAAAAGCTAG | A(6) |
a
This microsatellite locus position is very close to the locus position of MicrosatI in species B adenoviruses. MicrosatV does not exist in species B, much as MicrosatI does not appear to exist in species E (serotype 4), at least not in a polymorphic state. This suggests that either there is an adaptive reason to have microsatellites in this genomic region (but little selection for what kind) or that this entire region is under very little constraint in terms of variability. The position analyzed is bp 10538 in AY599837, from the complete genome of HAdV-4 (10).