TABLE 1.
Oligonucleotide primers used in this study
| Primer | Sequence (5′-3′)a | Description |
|---|---|---|
| FlgB5′X | GCGTCTAGATACCCGAGCTTCAAGGAAGAT | Nucleotides 1-21 of the streptomycin resistance cassette plus the XbaI site |
| Strep 3′ | GCGTCTAGATTATTTGCCGACTACCTTGGTGAT | Complementary to nucleotides 1176-1199 of the streptomycin resistance cassette plus the XbaI site |
| CspA-US 5′ | TTACAGCTACAAGAAAAGTTTAAA | Nucleotides 377-400 upstream of B. burgdorferi cspA |
| CspA-DS 3′ | ATTTGCATTAGCAATGATTTAGAT | Complementary to nucleotides 576-599 downstream of B. burgdorferi cspA |
| BbB19 5′ | GCGCCGCGGGATTTTAAAATCAAATTAAGACAATA | Nucleotides 16751-16776 of B. burgdorferi cp26 plus the SacII site |
| BbB20 3′ | GCGTCTAGAAATTTTGTTTATATTTAAATGCTTAAA | Complementary to nucleotides 17725-17751 of B. burgdorferi cp26 plus the XbaI site |
| BbB21 5′ | GCGCTCGAGGGGTGCTAGAAATTTGATTTTAA | Nucleotides 17752-17774 of B. burgdorferi cp26 plus the XhoI site |
| BbB22 3′ | GCGGGTACCCAATTAAATATAAGGGGAAGTATA | Complementary to nucleotides 18728-18751 of B. burgdorferi cp26 plus the KpnI site |
| FlaB 5′ | GCGTCTAGATGTCTGTCGCCTCTTGTGG | Nucleotides 1-19 of the gfp expression construct plus the XbaI site |
| GFP 3′ | GCGGGATCCCTATTTGTATAGTTCATCCATGCC | Complementary to nucleotides 1048-1071 of the gfp expression construct plus the BamHI site |
| FIgB5′B | GCGGGATCCTACCCGAGCTTCAAGGAAGAT | Nucleotides 1-21 of the gentamicin resistance cassette plus the BamHI site |
| Gent 3′ | GCGGGATCCTTAGGTGGCGGTACTTGGGTCGA | Complementary to nucleotides 919-941 of the gentamicin resistance cassette plus the BamHI site |
| CspA-comp 5′ | GCGAAGCTTTTACAGCTACAAGAAAAGTTTAAA | Nucleotides 377-400 upstream of B. burgdorferi cspA plus the HindIII site |
| CspA-comp 3′ | GCGAAGCTTAGAAGAATTAACTTCTCTTTTTAM | Complementary to nucleotides 792-816 downstream of B. burgdorferi cspA plus the HindIII site |
a
Nucleotides in bold indicate restriction sites used for cloning.