Skip to main content
. 2009 Jun 30;28(1):93. doi: 10.1186/1756-9966-28-93

Table 2.

Sequence of Primers for Real-Time PCR1 Amplification

Primer for Direction Primer Sequence (5' to 3')
Human Prx I Forward tttggtatcagacccgaagc

Reverse tccccatgtttgtcagtgaa

Human Prx II Forward ccagacgcttgtctgaggat

Reverse acgttgggcttaatcgtgtc

Human Prx III Forward gttgtcgcagtctcagtgga

Reverse gacgctcaaatgcttgatga

Human Prx IV Forward cagctgtgatcgatggagaa

Reverse taatccaggccaaatgggta

Human Prx V Forward ccctggatgttccaagacac

Reverse aagatggacaccagcgaatc

Human Prx IV Forward cgtgtggtgtttgtttttgg

Reverse tcttcttcagggatggttgg

Human Trx1 Forward ctgcttttcaggaagccttg

Reverse tgttggcatgcatttgactt

Human Trx2 Forward agcccggacaatatacacca

Reverse aatatccaccttggccatca

1 Abbreviations: PCR, polymerase chain reaction; Prx, peroxiredoxin; Trx, thioredoxin.