Table 2.

Primers and plasmids used for this study

	primers
Designation	Sequence (5' -> 3') or description	use	Reference(s)
AtCPSF30 5'	AGATCTATGGAGGATGCTGATGGACTT	Cloning of the AtCPSF30 protein-coding region	This study
AtCPSF30 3'	CCGGAGATCTATGTCGGGCCTCCATCGATC	Cloning of the AtCPSF30 protein-coding region	This study
C-ter 30 5' (m9)	AGATCTGGAGCTGGGAGGGGTAGAAGTTTCCGTCAA	Cloning of the AtCPSF30 C-terminal protein-coding region	This study
N-ter 30 3' (m4)	GGGCCCAGGTCCAGGAAGCTTTGCATGCCTGTACCGACA	Cloning of the AtCPSF30 N-terminal protein-coding region	This study
AtDcp2 5'	CCGGAGATCTATGTCGGGCCTCCATCGATC3	Cloning of the AtDcp2 protein-coding region	This study
AtDcp2 3'	AATTGGGCCCCAAACTGACCAGTCAAGCTGAATTACCAG	Cloning of the AtDcp2 protein-coding region	This study
	plasmids
designation	source	use	Reference(s)
Salk clone U61209	ABRC; corresponds to At5g13570	Template for amplification of AtDcp2 sequences
pMAL-AtCPSF30	Hunt laboratory	Template for amplification of AtCPSF30 sequences	[14]
pMDC43C1-GFP::AtCPSF160, pMDC43C1-GFP::AtCPSF100, pMDC43C1-GFP-AtCPSF73(I) and GFP-AtCPSF73(II)	Dr. Q. Q. Li (Miami University, Oxford, OH)	Plasmids for the expression of GFP fused Arabidopsis CPSF factors 160, 100, 73CII and 73CI	[30]
pGD RFP, pGD RFP-NLS,	Dr. Michael Goodin (University of Kentucky, Lexington, KY)	pGD RFP vector was used to express different CPSF 30 clones; pGD RFP-NLS was used as control in GFP fusion studies.	[19]
pKLX80- AtZFP11-NLS::GFP, pKLX80-CoxII::GFP, pKLX80-ER::GFP	Dinkins laboratory		[20,22]