Figure 6.

(A) Luciferase fusion vectors containing a PvuII-SstI genomic fragment (−1560 to −1175) of the human VEGF gene promoter were cotransfected with expression vectors encoding either ERα or ERα containing a DNA binding domain mutation (DBD). After mutation of a putative ERE within the targeted upstream region, the luciferase fusion vector was cotransfected with ERα. After recovery overnight, the cells were treated with ethanolic vehicle (control) or 100 nM E₂ for 20 h. Error bars represent standard deviations in three different cultures. (B) Electrophoretic mobility-shift assay with oligonucleotides containing the putative ERE. ERs expressed in reticulocyte lysates and/or Ishikawa nuclear extracts (NE) were added to the labeled oligonucleotide probe (aatcagactgactggcctcagagccc). Binding competition was performed by adding cold probe at a 100-fold excess.