Table 2. Potential target-binding sites for regulators in the DAP3 gene promoter.
| Motif | Sequence | Start position | End position | Strand | Score |
|---|---|---|---|---|---|
| ELK1 | CTTACGGAAA | −458 | −449 | + | 5.92 |
| TTTCCCCTCG | 345 | 354 | − | 5.51 | |
| TGTCAGGGAC | −79 | −70 | − | 5.49 | |
| ELK4 | TCCGGGAGT | −93 | −85 | + | 4.87 |
| ACTGGAATT | 938 | 946 | + | 4.64 | |
| GTTTCCCCT | 344 | 352 | − | 4.17 | |
| ERR-α | TGTCCTCGA | −232 | −224 | − | 7.48 |
| AGACCTTGT | −270 | −262 | − | 6.41 | |
| TGACATTTA | −345 | −337 | − | 5.8 | |
| TCAGGGACA | −77 | −69 | + | 5.02 | |
| GABPA | AGAGGAAGGG | 898 | 907 | + | 7.18 |
| CTCCTCCGCT | 185 | 194 | − | 6.99 | |
| CCCTCCCGCT | 215 | 224 | − | 6.56 | |
| CGCGGCAGGG | −287 | −278 | + | 6.44 | |
| Hox11-CTF1 | AGGGAGGGAGCTAA | 418 | 431 | + | 3.27 |
| TTTCCCCTCGCAAA | 345 | 358 | + | 3.11 | |
| NRF1 | CGCGCGTGCGCC | 833 | 844 | + | 5.57 |
| CGCGCGTGCGCC | 833 | 844 | − | 5.49 | |
| AGCGCAGGCCCT | 690 | 701 | − | 4.75 | |
| RUNX1 | GACCACAAC | −679 | −671 | − | 6.05 |
| CACCACAGA | −276 | −268 | − | 4.74 | |
| TAL1-TCF3 | AGACCATCTGTC | −399 | −388 | + | 9.93 |
| ACCATCTGTCTG | −397 | −386 | − | 7.18 | |
| PPARG-RXRA | TTTTGGCCCTTCACATTTAC | −736 | −717 | − | 2.6 |
The POSSUM program and 125 TFBS motifs were used to analyse the DAP3 gene promoter region (−1000 to +1000 nucleotides around the TSS). The table shows the sequence, start and end positions of the motifs, the strand on the chromosome and the computed score for the highest-scoring TFBS motifs.