Skip to main content
. Author manuscript; available in PMC: 2010 Jul 31.
Published in final edited form as: Mutat Res. 2008 Dec 3;668(1-2):117–132. doi: 10.1016/j.mrfmmm.2008.11.017

Figure 2.

Figure 2

Fancj. A) Comparison of orthologous exons for zebrafish fancj (white) and human FANCJ (black). Insert: Plot of the length of each zebrafish exon vs. the length of its human orthologous exon. The diagonal indicates equality. B1.) A portion of Hsa17 including FANCJ. B2.) A portion of Dre15 including fancj. The order of five orthologs in a row including FANCJ/fancj is conserved between human and zebrafish genomes. B3.) A portion of Dre5 containing duplicates of genes near fancj (lhx1b/lhx1a; tbx2a/tbx2b; and zgc:103518/zgc:55836) but not fancj. B4.) Part of Hsa17 orthologous to a portion of Dre5. B5.) We mapped fancj to Dre15 using primers CCCCTGTAAAGCGTATCCCTCTCA and TTGCAATAACAGACAGAATAGATGGACTCA (NW_001877562 nucleotides 1506166–1506522).