Skip to main content
. Author manuscript; available in PMC: 2010 Jul 31.
Published in final edited form as: Mutat Res. 2008 Dec 3;668(1-2):117–132. doi: 10.1016/j.mrfmmm.2008.11.017

Figure 3.

Figure 3

Fancm and Fancn. A.) Fancm. A1.) Part of Dre17 containing fancm. We mapped fancm using mapping primers TGGCTAGTGAAAATGGCGAGTGG and TACGGCTGAGTGGAGGAACATTACA (NW_001881046 nucleotides 6059–6298). A2.) Part of Hsa14 containing FANCM. A3.) Much of Dre20 is a duplicate of Dre17, but it has no fancm ortholog. A4.) Hsa14 showing the location of FANCM. B. Fancn. B1.) Part of Dre1 containing fancn. B2.) Six of eight genes surrounding FANCN have orthologs surrounding fancn. B3.) The two genes flanking FANCN in Hsa16 have orthologs on Dre3, but there is no fancn gene between them. NDUFAB1 is duplicated on Dre3 and Dre1 (ndufab1b and zgc:92607). B4.) Hsa16 showing the location of FANCN.