Table 1.

Sequence of oligonucleotides used to generate the DNA clustered damage sites

Position	Sequence	Name
−5	5′-ctcttagtcaggaaYatgtctctatgctgggagcaaaggc	Tg−5
	3′-gagaatcagtccttatacaXagatacgaccctcgtttccg
−1	5′-ctcttagtcaggaatatgYctctatgctgggagcaaaggc	Tg −1
	3′-gagaatcagtccttatacaXagatacgaccctcgtttccg
+1	5′-ctcttagtcaggaatatgtcYctatgctgggagcaaaggc	Tg + 1
	3′-gagaatcagtccttatacaXagatacgaccctcgtttccg
+5	5′-ctcttagtcaggaatatgtctctaYgctgggagcaaaggc	Tg + 5
	3′-gagaatcagtccttatacaXagatacgaccctcgtttccg
control 1	5′-ctcttagtcaggaatatgtctctatgctgggagcaaaggc	Control AP, Control 8-oxoG
	3′-gagaatcagtccttatacaXagatacgaccctcgtttccg
control 2	5′-ctcttagtcaggaatatgYctctatgctgggagcaaaggc	Control Tg
	3′-gagaatcagtccttatacagagatacgaccctcgtttccg
control 3	5′-ctcttagtcaggaatatgtctctatgctgggagcaaaggc	No damage
	3′-gagaatcagtccttatacagagatacgaccctcgtttccg

X represents either 8-oxoG, an AP site or a HAP1-SSB (following conversion of uracil to AP site and to a HAP1-SSB as described in Materials and Methods section); Y represents thymine glycol. −5 and −1 indicate the positions on the complementary strand of the X base 3′ from Y base. +1 and +5 are the positions on the complementary strand of the X base 5′ from the Y base. Control 1 is control oligonucleotide containing ether an AP site, a HAP1-SSB or 8-oxoG as a single lesion. Control 2 is the control oligonucleotide containing Tg as a single lesion. Control 3 is the control oligonucleotide containing no damage.