Figure 2.

Genetic selection for SmpB mutants that restore A86C tmRNA activity. Translation of a truncated KanR gene is stalled during termination at the sequence Glu-Pro-Stop. The resulting KanR protein lacks the C-terminal 15 amino acids (red) and is inactive unless these stalled ribosomes are rescued by tmRNA that has been altered to encode the last 14 amino acids, ANKLQFHLMLDEFF.⁴ Roughly 10⁸ SmpB mutants were screened to identify those that restore tagging levels sufficient to synthesize KanR and confer cellular survival on kanamycin plates. SmpB library construction – EagI and EcoRV cloning sites in the selection plasmid⁹ were used to insert the SmpB gene mutagenized by error-prone PCR³³ with the following primers: 392, GGTATCAACAGGGACACCAGG and 470, CCAGTCACGTAGCGAAGATC. The SmpB library was introduced into MegaX DH10B competent cells (Invitrogen) by electroporation and was amplified, purified, and then introduced into the ΔssrA-smpB strain (a gift from Brice Felden)³⁴ for selection in the KanR assay. KanR assay for tmRNA activity – ΔssrA-smpB cells expressing A86C tmRNA and SmpB from the selection plasmid were grown overnight in 2xYT with ampicillin. Saturated cultures were diluted to an OD₆₀₀ of approximately 0.3 in fresh media containing 2% arabinose to induce KanR expression and grown for 4 hours. The cells were plated onto selective media: 2xYT, ampicillin, chloramphenicol, 2% arabinose, and 15 µg/mL kanamycin. Growth comparisons (selective vs. non-selective plates) were made after incubation for 48 h at 25 °C. Mutant smpB genes from selected clones were amplified by PCR and cloned into fresh selection vector and re-introduced into the selection strain to verify their phenotype.