Table 3.
Primer sequences used to amplify the two (A)n microsatellites in the rps16 intron and the complex microsatellite in the trnL-trnF intergenic spacer (cyp2)
| Region | Primer | Sequence (5′ to 3′) | Reference |
|---|---|---|---|
| rps16-1 | rps16-1F | CTTGTCTCAACAATTGGATC | This paper |
| rps16-1R | CGTACTCCTAACTCAAGTTG | This paper | |
| rps16-2 | rps16-2F | CAACTTGAGTTAGGAGTACG | This paper |
| rps16-2R* | See Table 2 | Oxelman et al. (1997) | |
| cyp2 | trnL-trnF | GGTTCAAGTCCCTCTATCCC | Taberlet et al. (1991) |
| cyp2-R | CGGATCCATTTGTTAAAGAACAG | Fay and Cowan (2001) |
* The original rps16 reverse primer for amplification of the whole locus was used due to the proximity of the microsatellite region to the end of the amplified sequence.