Skip to main content
. Author manuscript; available in PMC: 2010 Jul 1.
Published in final edited form as: Neurosurgery. 2009 Jul;65(1):138–145. doi: 10.1227/01.NEU.0000348049.81121.C1

Figure 2. Genetic and LCM analyses.

Figure 2

A. Sequence analysis of KRIT1 exon 14 clones generated from DNA isolated from individual 410’s lesion using exon 14 genomic primers. The allele with the somatic G deletion located 1300 bp from the ATG start includes wt sequence (C) at base 1363 and is biallelic to the germline T mutation at base 1363. B. The 34-bp deletion was found only in the vascular endothelial cells (CD31+) LCM isolated from pristine caverns and not found in surrounding fibrotic tissue or from individual 354’s blood using exon 15 genomic primers (F- AAGCAGTTAACCACAAATTGG and R-GAAACTCAACAGATTTTGTGC).