TABLE 1.
Bacterial strains, plasmids, and primers used in this study
| Strain, plasmid, or primer | Relevant characteristics or sequence | Reference or source |
|---|---|---|
| E. coli strains | ||
| DH5α | F′ endA1 hsdR17 supE44 thi-1 recA1 gyrA relA1 (lacZYA-argF)U169 deoR [80dlac(lacZ)M15recA1] | 44 |
| JM109 | recA1 endA1 gyrA96 thi hsdR17 supE44 relA1 Δ(lac-proAB) mcrA [F′ traD36 proAB lacIqlacZΔM15 | 63 |
| C. violaceum CV026 | Double mini-Tn5 mutant from C. violaceum ATCC 31532, AHL biosensor | 36 |
| P. putida F117 | AHL-negative derivative of P. putida IsoF; PpuI− | 50 |
| P. aeruginosa strains | ||
| PAO1 | Wild type | 21 |
| PAO1lasI::Gm | PAO1 with Gm cartridge inserted into unique EcoRI site of lasI | 3 |
| PAO1rhlI::Tc | PAO1 with Tc cartridge inserted into unique EcoRI site of rhlI | 3 |
| PAO1rsaL | rsaL::ISlacZ-hah | 42 |
| PUPa3 | Wild type, rice rhizosphere isolate | 28 |
| LASI | lasI::Km of P. aeruginosa PUPa3; Kmr | This study |
| LASR | lasR::Km of P. aeruginosa PUPa3; Kmr | This study |
| RHLI | rhlI::Gm of P. aeruginosa PUPa3; Gmr | This study |
| DMI | lasI::Km rhlI::Gm of P. aeruginosa PUPa3; Kmr Gmr | This study |
| DMR | lasR::Km rhlR::Tet of P. aeruginosa PUPa3; Kmr Tetr | This study |
| RSAL | rsaL::Tc of P. aeruginosa PUPa3; Tetr | This study |
| Plasmids | ||
| pKRC12 | pBBR1MCS-5 carrying PlasB-gfp (ASV) Plac-lasR; Gmr | 43 |
| pSB1075 | lasR-PlasI luxCDABE; Ampr | 61 |
| pRK2013 | Tra+ Mob+ ColE1 replicon; Kmr | 15 |
| pMOSBlue | Cloning vector; Ampr | Amersham-Pharmacia |
| pBluescript KS | Cloning vector; Ampr | Stratagene |
| pLAFR3 | Broad-host-range cloning vector, IncP1; Tetr | 49 |
| pIB101 | pLAFR3 containing P. aeruginosa PUPa3 DNA | This study |
| pIB103 | pLAFR3 containing P. aeruginosa PUPa3 DNA | This study |
| pMULTIAHLPROM | Broad-host-range plasmid containing eight luxI-type promoters fused to a promoterless lacZ gene; Tetr | 52 |
| pKNOCK-Km | Conjugative suicide vector; Kmr | 1 |
| pKNOCK-Gm | Conjugative suicide vector; Gmr | 1 |
| pKNOCK-Tet | Conjugative suicide vector; Tetr | 1 |
| pKNOCK-lasI | Internal PCR fragment of P. aeruginosa PUPa3 lasI cloned in pKNOCK-Km | This study |
| pKNOCK-rhlI | Internal PCR fragment of P. aeruginosa PUPa3 rhlI cloned in pKNOCK-Gm | This study |
| pKNOCK-rhlR | Internal PCR fragment of P. aeruginosa PUPa3 rhlR cloned in pKNOCK-Tet | This study |
| pKNOCK-rsaL | Internal PCR fragment of P. aeruginosa PUPa3 rsaL cloned in pKNOCK-Tet | This study |
| Primers | ||
| lasI-for | GAAATCGATGGTTATGACGC | This study |
| lasI-rev | CGGCACGGATCATCATCTTC | This study |
| rhlI-for | TCAGGTCTTCATCGAGAAGC | This study |
| rhlI-rev | CGTTGCGAACGAAATAGCG | This study |
| rhlR-for | TGGATCCGGCGATCCTCAAC | This study |
| rhlR-rev | GCTCTAGAGCTTCTGGGTCAGCAACT | This study |
| rsaL-for | TTGGATCCACCCGCACCGCCCGAC | This study |
| rsaL-rev | GCTCTAGATATATAGGGAAGGGCAGG | This study |