Table 1.
DNA | sequencea | Number of bases | description |
---|---|---|---|
probe | 5′-HS–(CH2)6–GCAGTATCTTCTATTTCTCCACACTGC–MB-3′ | 27 | probe modified with MB |
ST-25 | 5′-GTG GAG AAA TAG AAG AT-3′ | 17 | complementary target with 17 bases |
ST-25-3M1 | 5′-GTG GTG AATTAG ATG AT-3′ | 17 | three separated mismatches |
ST-25-3M2 | 5′-GTG GAG TTTTAG AAG AT-3′ | 17 | three contiguous mismatches |
FC-22 | 5′-GCAGTGTG GAG AAATAG AAG AT-3′ | 22 | complementary target with 22 bases |
FC-27 | 5′-GCAGTGTG GAG AAA TAG AAG AT ACTGC-3′ | 27 | complementary target with 27 bases |
ML-28 | 5′-GCGTTTTTCGC GTG GAG AAA TAG AAG AT-3′ | 28 | target complementary with 17 bases and an 11-base tail forming a loop |
ML-38 | 5′-GCGTTTTTCGC GCAGT GTG GAG AAA TAG AAG AT ACTGC-3′ | 38 | target complementary with 27 bases and an 11-base tail forming a loop |
Underlined bases are those different from the normal target so they indicate mismatches and elongation of the target. Bases in italic type are designed to form a structured loop.