Table 1.
Sea lamprey olfactory organ CR gene expression from 454, EST and RT-PCR data.
| olfactory organ 454 transcripts | RT-PCR Results | ||||||||
| Gene | (Adult, Parasite) | olfactory | brain | liver | gill | kidney | gonad | RT-primer 5'-3' | Tm |
| 1681.OR230* | 3,4 | x | x | tcaataatggagtcgcttgc | 60 | ||||
| tctcacgttgaaatgccaag | |||||||||
| 2061.V1R320 | 0,2 | x | x | x | gcagtgtcgtggtctctcaa | 56 | |||
| gaatgtagcgcgagttctcc | |||||||||
| 18775.V1R342 | 3,1 | x | x | x | x | x | x | tctgataagcctcgcgttct | 54 |
| ctcgggcacatttggtattt | |||||||||
| 6425.OR330a | 1,5 | x | x | ccgtactgcgactacctcgt | 58 | ||||
| ggcactcgtagaggatgagc | |||||||||
| 2407.OR326 | 2,0 | x | x | x | x | gctcgaaggatttcaacagg | 57 | ||
| aggtcacggtcctcacaaag | |||||||||
| 3267.OR325 | 7,1 | x | x | x | gtagtggctttgggcatcat | 57 | |||
| cacgaatattgccacgaaaa | |||||||||
| 3721.TAAR351 | 2,0 | x | x | gtgtggaccttccaccaagt | 60 | ||||
| gcagctgcctgaagtagagg | |||||||||
| 9755.TAAR355a | 2,0 | x | x | gtagccatcgccttcttcag | 60 | ||||
| gaggcgtagaaccagcactc | |||||||||
| 16230.TAAR353 | 0,1 | x | ctgcgtcgactccttctacc | 52 | |||||
| ggaggagttcgtcagcatgt | |||||||||
| 3717.V1R311 | not detected | x | x | tgaagaatggggaactgctc | 54 | ||||
| atacaagagcaaccggcatc | |||||||||
| 1548.PRH340 | not detected | x | x | x | aacgtgaccaacctgctcat | 54 | |||
| gctgcatgagaaacacgaag | |||||||||
| 11722.V1R311 | not detected | x | atcaagacgctgctcatcct | 54 | |||||
| cccagcagatcacgaatatg | |||||||||
| 5673.OR343 | not detected | x | atcctcctgtgcaacctgtc | 60 | |||||
| ggccggcagatgtagaagta | |||||||||
| 2594.TAAR358 | not detected | x | tatctcttggctgccgttct | 50 | |||||
| gccggagacaaaaacacatt | |||||||||
| 107483.OR345 | not detected | x | tccacatccagatggtgttc | 60 | |||||
| ttggtgttctccaccaggtc | |||||||||
| 17613.OR230 | not detected, | atcatggtcacctcctacgc | 60 | ||||||
| pseudogene | ggcaaccagaagatcaggaa | ||||||||
| 9755.TAAR355b | 2,0 | no RT primers | |||||||
| 14718.TAAR353 | 1,0 | no RT primers | |||||||
| 2008.CASR839 | 1,1 | no RT primers | |||||||
| 10424.MGR935 | 1,1 | no RT primers | |||||||
| 3267.OR361 | 0,1 | no RT primers | |||||||
| 1268.OR328** | 0,0 | NCBI | ESTs | from | embryo | EG337313 | |||
| EG335699 | |||||||||
| 10796.OR320 | 2,2 | no RT primers | |||||||
| 12707.TAAR348 | 2,0 | no RT primers | |||||||
| 7812.OR322 | 1,0 | no RT primers | |||||||
| 14563.OR381 | 0,1 | no RT primers | |||||||
| 15806.TAP† | 1,0 | no RT primers | |||||||
Expression data is shown for a subset of lamprey CR genes, including all OR, TAAR and V1R genes detected by olfactory organ cDNA 454 sequencing. RT-PCR results, primer sequences, annealing temperatures and NCBI EST data are also included. Gonad includes both adult testis and undifferentiated gonad from parasites. The partial gene 1681.OR230 corresponds to three ESTs (EE739806, EE738866 and EB081557) from adult olfactory organ*. Two sequences from the NCBI EST database (EG337313 and EG335699) obtained from sea lamprey embryo map to the gene 1268.OR328**. Expression of a calcium-sensing receptor (2008.CASR839) and a metabotropic glutamate receptor (10424.MGR935) were detected in the olfactory organs of adult sea lamprey. A 540 bp EST represents a cellular nucleic acid binding protein† expressed in both adult olfactory organ and embryo that was not included in the phylogenetic analysis.