AMYLOID FORMATION IN HUMAN IAPP TRANSGENIC MOUSE ISLETS AND PANCREAS AND HUMAN PANCREAS IS NOT ASSOCIATED WITH ENDOPLASMIC RETICULUM STRESS

Abstract

Hypothesis

Supraphysiological levels of the amyloidogenic peptide human islet amyloid polypeptide (hIAPP) have been associated with beta cell endoplasmic reticulum (ER) stress. However, in human type 2 diabetes, levels of hIAPP are equivalent or decreased relative to matched controls. Thus, we sought to investigate whether ER stress is induced during amyloidogenesis at physiological levels of hIAPP.

Methods

Islets from hIAPP transgenic mice that develop amyloid, and non-transgenic mice that do not, were cultured for up to seven days in 11.1, 16.7 and 33.3 mmol/l glucose. Pancreata from hIAPP transgenic and non-transgenic mice and human subjects with or without type 2 diabetes were also evaluated. Amyloid formation was determined histologically. ER stress was determined in islets by quantifying mRNA levels of BiP, Atf4 and Chop, and alternate splicing of XBP-1 mRNA or in pancreata by immunostaining for BiP, CHOP and XBP-1.

Results

Amyloid formation in hIAPP transgenic islets was associated with reduced beta-cell area in a glucose- and time-dependent manner. However, amyloid formation was not associated with significant increases in expression of ER stress markers under any culture condition. Thapsigargin treatment, a positive control, did result in significant ER stress. Amyloid formation in vivo in pancreas samples from hIAPP transgenic mice or humans was not associated with upregulation of ER stress markers.

Conclusions/interpretation

Our data suggest that ER stress is not an obligatory pathway mediating the toxic effects of amyloid formation at physiological levels of hIAPP.

Introduction

Deposition of islet amyloid, formed from the beta cell peptide islet amyloid polypeptide (IAPP), occurs in ∼90% of individuals with type 2 diabetes and is associated with reduced beta cell volume [1, 2]. Human IAPP (hIAPP) is amyloidogenic, and in vitro studies show that early aggregates or oligomers of hIAPP are cytotoxic and induce apoptosis [3–7], while rodent IAPP is not amyloidogenic [8]. Thus, hIAPP and/or the process of islet amyloid formation likely contribute to the decreased beta cell mass observed in type 2 diabetes by inducing beta cell apoptosis [9]. We and others have developed transgenic mice with beta cell expression of hIAPP as models of islet amyloid formation (reviewed in [10]). Cultured islets from these transgenic mice develop amyloid in a time- and glucose-dependent manner [11] and this amyloid is associated with decreased beta-cell area, reduced islet cell viability [11] and increased beta cell apoptosis [12].

Aggregation of hIAPP involves a conformational change to predominantly beta-sheet structure [8, 13]. All amyloidogenic peptides undergo this conformational change, leading to the hypothesis that amyloid formation is associated with protein misfolding [14]. Normal trafficking of secretory proteins such as insulin and IAPP through the endoplasmic reticulum (ER) is monitored to prevent misfolding or aggregation [15]. Under physiological conditions, accumulation of proteins in the ER triggers the adaptive unfolded protein response [16, 17]. This response includes three major pathways: signaling through inositol requiring and ER to nucleus signaling kinase 1 (IRE1), proteolysis and activation of activating transcription factor 6 (ATF6) and signaling through PKR-like ER kinase (PERK) [16]. Activation of all three pathways increase expression of ER chaperone proteins (including Ig binding protein (BiP)), increase degradation of misfolded proteins and attenuates new protein synthesis [16, 17]. Under adverse conditions, such as increased cytokines [18, 19] or free fatty acid exposure [19, 20], these mechanisms are no longer capable of protecting the cell, and this normally adaptive unfolded protein response becomes an ER stress response. Under conditions of ER stress, expression of pro-apoptotic genes including C/EBP homologous protein (CHOP), also known as growth arrest and DNA damage 153 (GADD153) is increased and the cell undergoes apoptosis [21].

Markers of ER stress have been shown to be increased, to variable degrees, in post-mortem pancreas samples [20, 22, 23] and isolated islets from individuals with type 2 diabetes [23], where amyloid deposition is known to occur. In other amyloid-related diseases, ER stress-mediated cell death has been shown to occur in response to aggregation of the amyloidogenic peptides amyloid-beta [24] and the prion protein PrP^Sc [25]. Recently, two groups have demonstrated ER stress following treatment of islets with exogenous hIAPP [26] or in islets with high expression rates of hIAPP [22, 27]. In the latter case, ER stress occurred with over-expression of amyloidogenic hIAPP but not with over-expression of non-amyloidogenic rodent IAPP [27]. However, these studies cannot exclude the possibility that the marked increase of amyloidogenic hIAPP, rather than aggregation of hIAPP per se, were responsible for the observed ER stress response. In the present study, we investigated whether induction of ER stress occurs during amyloid formation in the presence of physiological levels of hIAPP, and whether ER stress may thereby mediate some of the cytotoxic effects of hIAPP aggregation.

Methods

Islet Isolation and Culture

Islets were isolated from 10-week old male and female hemizygous hIAPP transgenic mice or non-transgenic littermate controls on an F1 C57BL/6 x DBA/2 background as we have done previously [11, 28]. Wild type breeders were from Jackson Laboratories (Bar Harbor, ME, USA). Studies were approved by the Institutional Animal Care and Use Committee of the VA Puget Sound Health Care System. Islets were handpicked and cultured overnight in RPMI-1640 containing 10% fetal bovine serum, 100 U/ml penicillin, 100 µg/ml streptomycin and 11.1 mmol/l glucose. Islets were then cultured for seven days in medium containing 5.5, 11.1, 16.7 or 33.3 mmol/l glucose (n=4–6 per condition) or for up to seven days in 16.7 mmol/l glucose (n=3–4 per condition). To provide a positive control for the induction of ER stress, a subset of hIAPP transgenic or non-transgenic islets were cultured in the presence of 16.7 mmol/l glucose + 0.3 µM thapsigargin for the final four hours of the culture period.

Use of 5.5 or 11.1 mmol/l Glucose as the Control Culture Condition

Initially, 5.5 mmol/l glucose was used as the control culture condition. However, culture of hIAPP transgenic (data not shown) or non-transgenic islets for seven days in 5.5 mmol/l glucose was associated with a 5.1±0.8 fold increase in mRNA levels for the pro-apoptotic gene Chop (p=0.001, n=5), relative to islets cultured in 11.1 mmol/l glucose. No change in BiP or Atf4 mRNA levels (1.3±0.1 and 1.4±0.1 fold increase over 11.1 mmol/l glucose, respectively) were seen under the same culture conditions, and no alternate splicing of Xbp-1 mRNA was observed (data not shown), suggesting that culture of mouse islets for seven days in 5.5 mmol/l glucose is associated with a stress response that is distinct from the ER stress response. Thus, 5.5 mmol/l glucose was determined to be an inappropriate control condition and therefore all data are compared to 11.1 mmol/l glucose as the control condition.

Histological Measurement of Amyloid Deposition and Beta Cell Area in Cultured Islets

Islets were fixed for 30 minutes at 4°C in 4% (w/v) phosphate-buffered paraformaldehyde, and embedded in agar and then in paraffin as we have done previously [28]. Ten-µm sections were cut and sections at 100 µm intervals throughout the islet pellet were stained with thioflavin S to visualize amyloid deposits and insulin antibody to visualise beta-cells [28]. Islets were visualised in the thioflavin S channel where the islet outline is clearly visible and the cross-sectional area of each islet was computed using Image Pro Plus (Media Cybernetics, Inc., Bethesda, MD, USA). Thioflavin S and insulin-positive areas within each islet cross section were then determined.

An average of 28 islets per experimental condition were analyzed. Investigators were blinded to the genotype and experimental treatment of each sample. From these data, islet amyloid prevalence (% islets containing thioflavin S positive staining) and islet amyloid severity (Σ thioflavin S area / Σ islet area x 100%), islet area and beta-cell area (expressed as µm² or % islet area) were determined.

RNA Isolation and Quantitative Real Time PCR

Total islet RNA was isolated from 25 islets per condition (High Pure RNA isolation kit, Roche Applied Science, Indianapolis, IN, USA) and reverse transcribed (High Capacity cDNA Archive kit, Applied Biosystems, Foster City, CA, USA). Levels of mRNA expression for BiP, Chop and Atf4 were measured in triplicate by real-time quantitative PCR using TaqMan assays on demand (Applied Biosystems), with 18S ribosomal RNA levels serving as the endogenous control, as we have described previously [29]. mRNA levels were expressed relative to an experimental control (either non-transgenic islets cultured for seven days in 11.1 mmol/l glucose or non-transgenic islets harvested on day 1, depending on the experimental paradigm) using the ^ΔΔCt method.

Alternate splicing of Xbp-1 mRNA was determined from islet cDNA by PCR of a fragment of Xbp-1 cDNA (using oligonucleotide primers TCCTTCTGGGTAGACCTCTGGGAG and AAACAGAGTAGCAGCGCAGACTGC). The normal Xbp-1 PCR product is 473 bp, while the spliced form is 447 bp. The PCR product was subjected to restriction digestion with PstI, which cleaves only the normal, unspliced form of XBP-1 cDNA (generating fragments of 290 and 183 bp). Reaction products were separated by agarose electrophoresis.

Immunohistochemical Assessment of ER Stress In Vivo

Pancreata were obtained from male hIAPP transgenic mice or and age-matched non-transgenic mice (n=3 per genotype) following one year of high fat feeding (diet containing 45% kcal from fat, D12290 from Research Diets, Inc., New Brunswick, NJ, USA) that we have previously shown to be associated with islet amyloid formation, loss of beta cell area and beta cell secretory dysfunction [30]. Human pancreata were obtained from autopsy cases (n=3) from the University of Washington or VA Puget Sound Health Care System Pathology Departments. The studies using human autopsy samples were approved by the Human Subjects Review Committee at the University of Washington.

Pancreas samples were fixed in 4% (w/v) phosphate-buffered paraformaldehyde (for mouse pancreas) or in neutral-buffered formalin (for human pancreas), embedded in paraffin and five-µm sections were cut. Sections subjected to antigen retrieval consisting of 20–40 minute incubations in Tris-EDTA buffer, pH 8.0 in a container submerged in a boiling water bath. Non-specific binding was blocked by incubation in phosphate-buffered saline containing 1 % (w/v) BSA and 2 % (v/v) normal goat serum. Primary antisera were as follows. BiP antisera were 610979 (lot 59027; BD Biosciences, San Jose, CA, USA), diluted 1:500 (mouse pancreas) or 1:100 (human pancreas) and SPA-826 (lot 06050826; Stressgen Bioreagents, Ann Arbor, MI, USA) diluted 1:100. CHOP antisera were ab11419 (lot 559553; AbCam, Cambridge, MA, USA) diluted 1:100 and sc-575 (lots D0103, E0207 and G1708; Santa Cruz Biotechnology, Inc., Santa Cruz, CA, USA) diluted 1:100. Lot D0103 of the CHOP antibody sc-575 was kindly provided by Dr. Ross Laybutt (Garvan Institute of Medical Research, Sydney, Australia). XBP-1 antibody was sc-7160 (lot G2607) from Santa Cruz Biotechnology, diluted 1:50. All antisera were reported to cross-react with both mouse and human ER stress markers. Sections were incubated overnight at 4°C in primary antibody, then incubated for one hour at room temperature with the appropriate biotinylated secondary antibody, diluted 1:200 (Jackson ImmunoResearch, West Grove, PA, USA) followed by avidin-biotin-horseradish peroxidase conjugate (Vectastain ABC Elite, Vector Laboratories, Burlingame, CA, USA). Antibody binding was visualized with 3,3′-diaminobenzidine and sections were counterstained with haemotoxylin. Thioflavin S and insulin staining were performed as described above.

Data Analysis

Data are expressed as mean ± SEM. Data were compared by analysis of variance with post-hoc analysis or by non-parametric test (Kruskal Wallis or Mann Whitney U) if the data were not normally distributed. A p≤0.05 was considered statistically significant.

Results

Islet Amyloid Formation in Cultured Islets

As we have shown previously, culture of hIAPP transgenic islets for seven days in 16.7 or 33.3 mmol/l glucose is associated with a dose-dependent increase in islet amyloid formation, while very little amyloid deposition is present in islets cultured for the same period in 11.1 mmol/l glucose (Table 1). Similarly, islet amyloid severity increases over time, when hIAPP transgenic islets are cultured in 16.7 mmol/l glucose (Table 2). Amyloid formation occurring in response either to increased glucose or duration of culture at 16.7 mmol/l glucose was associated with reduced beta-cell area (Table 1 and Table 2).

Table 1.

Morphometric analyses of hIAPP transgenic and non-transgenic islets cultured for seven days in 11.1, 16.7 or 33.3 mmol/l glucose.

Genotype	hIAPP Transgenic			Non-transgenic
Glucose (mmol/l)	11.1 (n=4)	16.7 (n=4)	33.3 (n=4)	11.1 (n=4)	16.7 (n=4)	33.3 (n=4)
Amyloid prevalence (%)	30±7a	46±16a	65±6a,c	0	0	0
Amyloid severity (%)	0.3±0.04a	2.1±1.3a	3.3±0.5a,c	0	0	0
Islet cross sectional area (µm2)	11505±905	12074±1631	12355±935	13282±857	12726±651	11574±1486
Beta-cell area (µm2)	7055±779	6001±847	5434±651	9188±494	7620±168	6653±815
Beta-cell area / islet area (%)	61.1±3.7a	49.5±1.9a,c	43.3±3.8b,c	69.3±1.0	61.6±3.2	57.7±1.5d

^ap<0.05

^bp<0.005 vs NT cultured at the same glucose concentration

^cp<0.05 vs T 11.1

^dp<0.05 vs NT 11.1.

Table 2.

Morphometric analyses of hIAPP transgenic islets cultured for 1, 3, 5 and 7 days in 16.7 mmol/l glucose.

Culture day	Day 1 (n=4)	Day 3 (n=4)	Day 5 (n=4)	Day 7 (n=4)
Amyloid prevalence (%)	3.5±2.4	55±19	74±12a	67±14a
Amyloid severity (%)	0.003±0.003	1.5±1.0	2.2±0.7a	3.0±1.2a
Islet cross sectional area (µm2)	10441±1497	8283±1326	11466±1912	9425±879
Beta-cell area (µm2)	6463±1082	4652±1363	5249±500	4460±802
Beta-cell area / islet area (%)	61.7±1.5	54.9±7.7	46.3±3.4	46.9±4.1

^ap<0.05 vs Day 1

Effect of Increasing Glucose on ER Stress Markers in Cultured Islets

Culture of either hIAPP transgenic (not shown) or non-transgenic islets for seven days in 16.7 mmol/l glucose, with addition of 0.3 µM thapsigargin for the last four hours being associated with significant increases in BiP, Atf4 and Chop mRNA levels (Figure 1) and with a marked increase in alternative splicing of Xbp-1 mRNA (Figure 2).

Figure 1.

mRNA levels by real time PCR for BiP (panel a), Atf4 (panel b) and Chop (panel c), in non-transgenic (open bars) or hIAPP transgenic mouse islets (solid bars) cultured for 7 days in 11.1, 16.7 or 33.3 mmol/l glucose or in non-transgenic islets 16.7 mmol/l glucose + 0.3 µM thapsigargin (grey bars) for the final four hours (n=4–6 per condition). While thapsigargin treatment led to marked increases in mRNA levels of all three ER stress markers, there were no significant differences in BiP, Atf4 or Chop mRNA levels among non-transgenic or hIAPP transgenic islets at any glucose concentration.

Figure 2.

Xbp-1 mRNA splicing products analyzed by agarose gel electrophoresis in non-transgenic (lanes 1–3) or hIAPP transgenic mouse islets (lanes 4–6) cultured for seven days in 11.1 (lanes 1 and 4), 16.7 (lanes 2 and 5) or 33.3 mmol/l glucose (lanes 3 and 6) or non-transgenic islets cultured for seven days in 16.7 mmol/l glucose + 0.3 µM thapsigargin for the final four hours (Th). The four bands on the gel are the PCR products from intact (473 bp) normally spliced Xbp-1 mRNA and its two digestion products produced from PstI restriction digestion (product 1 at 290 bp and product 2 at 183 bp) and the alternatively spliced form of Xbp-1 mRNA (447 bp). While thapsigargin treatment led to almost complete generation of the alternatively spliced Xbp-1 mRNA, there were no differences in the proportion of the four bands in any of the experimental conditions, suggesting that there were no differences in Xbp-1 mRNA splicing among non-transgenic or hIAPP transgenic islets at any glucose concentration.

In contrast, seven days of culture in 16.7 or 33.3 mmol/l glucose, conditions that are associated with increased amyloid deposition in hIAPP transgenic islets respectively (Table 1) was not associated with any changes in BiP, Atf4 or Chop mRNA levels (Figure 1), or with alternate splicing of Xbp-1 mRNA (Figure 2).

Effect of Time on ER Stress Markers in Cultured Islets

In order to determine whether changes in ER stress markers occur only during the early stages of islet amyloid formation, samples were taken from hIAPP transgenic and non-transgenic islets on days one to seven of culture at 16.7 mmol/l glucose. On day one there was very little visible amyloid formation while at subsequent time points there was a progressive increase in amyloid formation over time (Table 2). Culture of hIAPP and non-transgenic islets over seven days at 16.7 mmol/l glucose was not associated with a time-dependent increase in BiP, Atf4 or Chop mRNA levels (Figure 3). No changes in Xbp-1 mRNA splicing were observed over the seven-day culture period in either hIAPP transgenic or non-transgenic islets (Figure 4). In fact, Atf4 and Chop mRNA levels decreased from day 1 to day 2 in both hIAPP transgenic and non-transgenic islets, in keeping with recovery from islet isolation being associated with decreased expression of ER stress markers.

Figure 3.

mRNA levels by real time PCR for BiP (panel a and b), Atf4 (panel c and d) and Chop (panel e and f), in non-transgenic (open bars; panels a, c and e) or hIAPP transgenic mouse islets (solid bars; panels b, d and f) cultured for up to 7 days in 16.7 mmol/l glucose. Atf4 and Chop mRNA levels decreased between day 1 and day 2 in both genotypes, but there were no significant differences in BiP, Atf4 or Chop mRNA levels between non-transgenic or hIAPP transgenic islets at any time point (n=3 per condition).

Figure 4.

Xbp-1 mRNA splicing products analyzed by agarose gel electrophoresis as described in Figure 2 in non-transgenic or hIAPP transgenic mouse islets (lanes 1–7; days 1–7 respectively) cultured for up to seven days in 16.7 mmol/l glucose or in 16.7 mmol/l glucose + 0.3 µM thapsigargin for the final four hours (Th). While thapsigargin treatment led to almost complete generation of the alternatively spliced Xbp-1 mRNA, there were no differences in Xbp-1 mRNA splicing between non-transgenic or hIAPP transgenic islets at any time point.

Amyloid Formation and ER Stress Markers In Vivo

To determine whether islet amyloid formation in vivo was associated with alterations in levels of ER stress markers we examined both mouse and human pancreas samples with and without islet amyloid.

Pancreas sections were from hIAPP transgenic mice and non-transgenic controls fed a high fat diet for one year, an intervention associated with islet amyloid formation, decreased beta-cell area and secretory dysfunction [30]. Insulin and thioflavin S staining demonstrate the expected amyloid deposition and decreased beta-cell area in hIAPP transgenic mice compared to non-transgenic mice (Figure 5a and 5e). Immunostaining for BiP and XBP-1 were both present at similar levels in islets from hIAPP transgenic and non-transgenic mice (Figure 5b, c, f and g). The staining pattern for BiP in mouse pancreas was similar with both antisera (610979 or SPA-826). CHOP staining was not seen in either genotype (Figure 5d and 5h); neither antiserum (sc-575 or ab11419) showed positive staining. Note that faint nuclear staining (antibody ab11419) was present in non-transgenic mice, but this was present in all islet cells and in some exocrine cells, suggesting that it was likely non-specific.

Figure 5.

Pancreas sections from high fat fed non-transgenic (panels a-d) and hIAPP transgenic (panels e–h) mice and from human subjects without diabetes (panels i–l), with type 2 diabetes but without amyloid deposition (panels m–p), and with type 2 diabetes and significant amyloid deposition (panels q–t). Pancreas sections were stained for insulin + thioflavin S (panels a, e, i, m, q), BiP (panels b, f, j, n, r), XBP-1 (panels c, g, k, o, s) or CHOP (panels d, h, l, p, t). Amyloid deposition and decreased beta cell area were evident in amyloid-containing pancreata from the hIAPP transgenic mouse and the human subject with type 2 diabetes (panels e and q). BiP and XBP-1 immunostaining were present to an equivalent degree in islets from both non-transgenic and hIAPP transgenic mice, whereas CHOP immunostaining was not observed in mouse pancreas. Note that the faint nuclear staining in non-transgenic mouse pancreas (panel d) is deemed to be non-specific staining as it is present to a similar degree throughout the islet and exocrine pancreas. BiP and XBP-1 staining were absent from human islets, whereas cytoplasmic staining for CHOP was present in islets from subjects with type 2 diabetes, regardless of the presence of amyloid.

Immunostaining for the same ER stress markers was then performed in human autopsy pancreas sections. These samples were from one non-diabetic control subject, with no amyloid deposition (Figure 5i) and two individuals with type 2 diabetes, that differed with respect to islet amyloid deposition (no amyloid in one case, Figure 5m and 10% amyloid severity in the other, Figure 5q). BiP immunoreactivity (using SPA-826) was faintly visible in control islets (Figure 5j) and was increased in islets from individuals with diabetes, regardless of the presence of amyloid (Figure 5n and 5r). No BiP immunoreactivity was seen using Figure 5j (data not shown). XBP-1 staining was not readily detectable in human pancreata with or without diabetes (Figure 5k, o and s). In contrast, CHOP immunostaining (using AB11419) was present in islets from individuals with diabetes (Figure 5p and 5t), but not control islets (Figure 5l). No CHOP immunostaining was seen using sc-575 (not shown). CHOP staining did not differ between diabetes subjects with or without amyloid deposition and staining was localized to the cytoplasm rather than the nucleus.

Discussion

We have demonstrated that the ER stress response is not induced during amyloid deposition in cultured transgenic mouse islets expressing physiological levels of hIAPP. Culture of hIAPP transgenic islets for seven days in increasing glucose resulted in a dose-dependent increase in islet amyloid deposition [11], but no change in BiP, Atf4 or Chop mRNA levels, nor in changes in splicing of Xbp-1 mRNA. To rule out the possibility that induction of the ER stress response may have been transitory and that changes were not detectable after seven days of culture, we also analysed ER stress markers every 24 hours during seven days of culture in 16.7 mmol/l glucose. We observed a time-dependent increase in islet amyloid formation [11], but no increases in ER stress markers were observed. In fact, Atf4 and Chop mRNA levels were higher at day one than for the remainder of the study, suggesting some residual stress response following islet isolation. However, the increased Atf4 and Chop mRNA levels occurred early in the culture period and were equivalent in hIAPP transgenic and non-transgenic islets, making it unlikely that these changes were associated with islet amyloid deposition. We confirmed our findings in cultured islets by immunostaining pancreas sections where amyloid deposition had occurred in vivo. While we detected BiP and XBP-1 immunostaining in mouse pancreas following high fat feeding, and BiP and CHOP immunostaining in human pancreas from subjects with diabetes, the staining intensity did not differ whether amyloid was present or absent. Thus, while in mice fed a high fat diet and humans with type 2 diabetes certain ER stress markers are upregulated, this does not appear to be related to the presence of amyloid. Taken together, our findings suggest that ER stress is not an obligatory pathway by which islet amyloid results in loss of beta cells. Our data are in line with a recent study showing that beta cell death in response to other toxic stimuli, such as cytokine treatment, can also occur independently of ER stress [31].

Culture of islets in increased glucose for seven days was not associated with an ER stress response in either hIAPP transgenic or non-transgenic islets. This is in line with two studies demonstrating that elevated free fatty acids but not increased glucose induced ER stress in insulinoma cell lines, primary beta cells, db/db mouse islets and human islets [20, 32]. However, it is in contrast to other studies that have demonstrated an effect of glucose concentrations of up to 30 mmol/l glucose to induce ER stress in rat islets [33] and in human islets from subjects with type 2 diabetes, but not normal controls following culture for 24 hours in 11.1 mmol/l glucose [23]. This highlights the marked differences that can occur in islets or cell lines from different strains or species. An effect of glucose to increase some ER stress markers over one to eight hours has been described [33, 34]. Since amyloid deposition occurs over days rather than hours, we did not investigate this acute response in the present study, but we cannot rule out the possibility that glucose induced ER stress over the short term. However the fact that, from 24 hours on, we observed no effect of elevated glucose in non-transgenic islets to upregulate ER stress markers allowed us to distinguish any effect of hIAPP expression and/or amyloid formation from that of glucose alone.

In contrast to the lack of effect of high glucose, culture of hIAPP transgenic and non-transgenic islets for seven days in low (5.5 mmol/l) glucose was associated with increased Chop mRNA. This resembled a low glucose-induced integrated stress response [33], rather than a classical ER stress response. These data, together with the fact that culture of hIAPP transgenic islets for seven days in either 5.5 or 11.1 mmol/l glucose is only associated with minimal amyloid deposition [11], justified the use of 11.1 mmol/l glucose as the control condition in this study. In addition, this highlights the caution needed when interpreting changes in markers of stress signaling in isolation. Measuring only CHOP which can be induced by several stressors [21, 35], rather than all three pathways of the ER stress response (IRE1, ATF6 and PERK) [16, 17], identifies that cells are under stress but gives limited insight into which specific stress response(s) is activated.

Consistent with in vitro studies showing an effect of free fatty acids to induce beta-cell ER stress [20, 32], we demonstrated BiP and XBP-1 immunostaining in mouse pancreas samples from animals fed a high fat diet for one year. Further, in line with our in vitro observations, amyloid formation in vivo in hIAPP transgenic high fat-fed mice was not associated with a further increase in BiP or XBP-1 immunostaining over that associated with high fat feeding alone in non-transgenic mice. Interestingly, we did not observe CHOP immunostaining in mouse pancreas, despite the use of two different anti-CHOP antisera (AB11419 and two different lots of sc-575) that have both previously been reported to produce positive staining under conditions of ER stress in the beta cell [20, 36]. This leads us to conclude that in hIAPP transgenic mice, amyloid-induced beta cell loss is not associated with marked increases in the ER stress response.

Elevated ER stress markers have been reported in other models of hIAPP overproduction and amyloid formation. Increased CHOP immunostaining has been reported in association with hIAPP-induced cell death in INS-1 cells overexpressing hIAPP and increased caspase 12 immunostaining in hIAPP-transgenic rat pancreas [22]; in addition other elements of the ER stress pathway were also upregulated in transgenic islets overexpressing hIAPP and not in islets overexpressing non-amyloidogenic rodent IAPP to the same degree [27]. While the levels of hIAPP were not quantified in this model, examination of the western blots demonstrates that the overexpression is marked [27]. Another study reported that extracellular treatment of MIN6 cells or cultured human islets with hIAPP resulted in induction of ER stress and cell death [26]. While these studies provide compelling evidence for a role of hIAPP in the ER stress response, it is important to note that both studies utilized expression or treatment of hIAPP at levels that are significantly higher than is normally seen. In normal humans the circulating levels of hIAPP are approximately 2% of insulin levels [37] and in fact, levels of hIAPP in human diabetes are decreased rather than increased [38, 39]. Our hIAPP transgenic mice produce hIAPP at a 1:1 ratio with endogenous mouse IAPP, and at a 2:100 level with insulin [30] providing a model of islet amyloid formation more akin to the physiological levels of hIAPP relative to insulin. Thus, our findings suggest that islet amyloid formation that occurs at physiological levels of hIAPP may not result in ER stress, but that marked increases in amyloidogenic hIAPP may result in an ER stress response.

Of note, the process of hIAPP aggregation is likely quite different from the misfolding of other well-described proteins that elicit a strong ER stress response. Mutations in the insulin 2 gene that disrupt disulfide bond formation result in proinsulin misfolding and marked ER stress, leading ultimately to beta cell apoptosis and diabetes [40, 41]. Other examples include mutations in the cystic fibrosis transmembrane receptor or alpha-1 antitrypsin, which again cause the proteins to become inherently misfolded and retained within the ER [42, 43]. In contrast, the soluble and aggregated forms of hIAPP do not differ in their amino acid sequence, and while hIAPP can be aggressively amyloidogenic in vitro, under normal conditions hIAPP is properly folded and secreted from the beta cell. Thus, hIAPP does not have an inherent tendency to induce ER stress, but can become aggregated under certain conditions. Our data support the concept that this aggregation is not associated with activation of an ER stress response.

The data regarding ER stress markers in type 2 diabetes where amyloid is known to occur, has been somewhat mixed. Several ER stress markers were shown to be elevated in pancreas from individuals with type 2 diabetes in one study [20], with only modest increases reported in another [23]. A third study suggested that ER stress markers are increased in type 2 diabetes; however, only CHOP was measured, making it difficult to conclude that the pathway induced was in fact ER stress [22]. We found that both BiP and CHOP immunoreactivity is increased in islets from subjects with type 2 diabetes compared to non diabetic control islets. However, importantly the CHOP staining we observed was cytoplasmic, not nuclear; the latter would be required to indicate increased CHOP activity in beta cells. Further, our findings demonstrate that the presence of BiP and CHOP immunoreactivity in human type 2 diabetes is unrelated to the presence of islet amyloid, as BiP and CHOP staining were both present in islets from individuals with diabetes whether or not amyloid was present. Many abnormalities exist in islets from individuals with type 2 diabetes, and it is therefore also not possible to ascribe the presence of an ER stress response in autopsy pancreas sections from type 2 diabetes to amyloid or any other single abnormality. It is likely, in fact, that any increase in ER stress markers in this disease state arise due to a combination of factors, resulting in accumulation of unfolded or misfolded proteins in the ER.

In summary, we have shown that islet amyloid formation, both in vitro and in vivo, is not associated with induction of the ER stress response, and that while hIAPP expression or aggregation may be associated with ER stress under certain conditions, it does not appear to be an obligatory mediator of the toxic effects of islet amyloid deposition.

Abbreviations

ATF4

activating transcription factor 4

ATF6

activating transcription factor 6

BiP

Ig binding protein

CHOP

C/EBP homologous protein

ER

endoplasmic reticulum

hIAPP

human islet amyloid polypeptide

IAPP

islet amyloid polypeptide

IRE1

inositol requiring and ER to nucleus signaling kinase 1

PERK

PKR-like ER kinase