Official websites use .gov
A
.gov website belongs to an official
government organization in the United States.
Secure .gov websites use HTTPS
A lock (
) or https:// means you've safely
connected to the .gov website. Share sensitive
information only on official, secure websites.
Gel electrophoresis of PCR product to genotype wfs1 targeting products. Mice were genotyped by multiplex PCR for both alleles using primers Wfs1KO_wf2 5' TTGGCTTGTATTTGTCGGCC 3', NeoR1 5' GACCGCTATCAGGACATAGCG 3' and WfsKO_uniR2 5' CCCATCCTGCTCTCTGAACC 3'. The upper band is for the wild-type allele; the lower band is for the mutant allele. The presence of two bands indicates a heterozygous mutant mouse.
