TABLE 2.
Primers used for amplification of boNT/B and nontoxic component genes
| Gene(s) included in amplified fragment | Primer pair sequences (5′-3′)a | Location (positions)a,b |
|---|---|---|
| ha70, ha17, and first half of ha33 | CAAAATATGATTTCCTTGT/AGCAGCATACCAGTTTT | 2725-2743/5578-5562 |
| Latter half of ha33, botR, and first half of ntnh | CGCGTAGATTAGTAATTG/AAGTGCATTATTAAATCTATCT | 5406-5423/8166-8145 |
| Latter half of ntnh | AGGAAATAATGCCATTG/CTTTATAATATCTCCCCGT | 8022-8038/10826-10808 |
| boNT/B light chain | TTTATGGGCATTAAAAG/CATCTGAAAAACTATTTTTAT | 10671-10687/12116-12096 |
| boNT/B heavy chain | AGAGGTCAGAATAAAGCTA/CAAAATTTAGCTACATCCT | 11948-11966/14682-14664 |
a
Sequences and positions are for forward primer/reverse primer.
b
Location of primer sequence of boNT/B and nontoxic component genes in the sequence reported under DDBJ accession no. AB232927.