Figure - PMC

Skip to main content

An official website of the United States government

Here's how you know

Here's how you know

Official websites use .gov
A .gov website belongs to an official government organization in the United States.

Secure .gov websites use HTTPS
A lock ( ) or https:// means you've safely connected to the .gov website. Share sensitive information only on official, secure websites.

View full-text article in PMC

. 2002 May 3;86(10):1592–1596. doi: 10.1038/sj.bjc.6600269

Search in PMC
Search in PubMed
View in NLM Catalog
Add to search

Copyright © 2002 Cancer Research UK

This article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if changes were made.The images or other third party material in this article are included in the article’s Creative Commons license, unless indicated otherwise in a credit line to the material.If material is not included in the article’s Creative Commons license and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this license, visit https://creativecommons.org/licenses/by/4.0/.

PMC Copyright notice

Genomic sequence. Analysis of genomic DNA was carried out from peripheral blood lymphocytes by direct sequencing of double stranded PCR products. A frameshift could be clearly seen starting after nucleotide 13160 in exon 5 (denoted by ↓). The insertion was found to be 7 base pairs in length and was a repeat of the 7 base pair sequence immediately before it. This frameshift would produce amino acid substitutions beginning with alanine to glycine at position 161 and a stop at position 182. Wild-type: CGCGCCATGGCCATCTA; Mutant: CGCGCCATGGGCCATGGCCATCTA