The env mRNA is the most likely source of the cRW9 epitope. We cloned and sequenced cDNAs from SIV-infected cells to narrow the search for the SIV mRNA that encodes the cRW9 epitope. We devised a PCR strategy (F_961-980, TGTTCCCATCTCTCCTAGCC; R_6960-6979, AATTGTCGCATTCCTCCAAG) that would selectively amplify nonspliced and partially spliced transcripts. All mRNAs identified had been previously described (18, 23). However, the Env-encoding mRNA contained features consistent with being the source mRNA for the cRW9 epitope. Most importantly, it contained rev exon 1, which is in frame with cRW9. Note that there is an AUG codon upstream of the rev start codon that, if translated, would encode just two amino acids before the next stop codon. The potential significance of this minimal open reading frame is unknown, and it is not included in analyses here. nt., nucleotide.