DCs transfected with the Env-encoding mRNA can present cRW9 as well as epitopes derived from Rev exon 1 and Env but not Rev exon 2. We synthesized the env mRNA in vitro using overlap extension PCR (outside primers, F_CGGAGAGGCTGGCAGATT and R_GGAGAAACCCAGCTGAAGA; overlapping internal primers, R_TCTCCGGAGGCCAACGTCCATCCGAACCCCTA and F_CCGGTTGCAGGTAGGCTTGGGGATATGTTATG; region of overlap is underlined). We cultured DCs from SIV-naïve animals that could present the following epitopes: cRW9 (restricted by Mamu-B*17 [15]), Env-FW9 (restricted by Mamu-B*17 [16, 17]), Rev-RT11 (in exon 1, restricted by Mamu-DPB1*06 [5]), and Rev-RL8 (in exon 2, restricted by Mamu-B*08 [13, 14]) as a negative control, as Rev exon 2 should not be translated from this mRNA (A). We transfected monocyte-derived DCs with the env mRNA and tested whether they were recognized by T-cell lines or clones specific for the epitopes in panel A. Recognition is measured as the percentage of epitope-specific T cells that produce gamma interferon (IFN-γ) and/or tumor necrosis factor alpha (TNF-α) upon recognition of transfected DCs, 12 hours after transfection. Cells either mock transfected (no mRNA) or transfected with irrelevant (irr.) mRNA (green fluorescent protein mRNA) were used as negative controls (B). The cRW9 epitope was translated from this mRNA, as were epitopes derived from Env and Rev exon 1, but not exon 2. The results are characteristic of two distinct assays.