Official websites use .gov
A
.gov website belongs to an official
government organization in the United States.
Secure .gov websites use HTTPS
A lock (
) or https:// means you've safely
connected to the .gov website. Share sensitive
information only on official, secure websites.
Primer sequences and length of PCR products for TNF-α, IL-1β, IL-10 and GAPDH
| Product | Forward primer | Reverse primer | Product size (bp) |
|---|---|---|---|
| TNF-α | ccaagggagagtggtcaggt | ggcaacaaggtagagaggc | 317 |
| IL-1β | atcactcattgtggctgtgg | gtcgttgcttggttctcct | 322 |
| IL-10 | tgctatgctgcctgctctta | gctccactgccttgctctta | 405 |
| GAPDH | accacagtccatgccatcac | tccaccaccctgttgctgta | 452 |
