Intersectin-2L Regulates Caveola Endocytosis Secondary to Cdc42-mediated Actin Polymerization

Abstract

Here we addressed the role of intersectin-2L (ITSN-2L), a guanine nucleotide exchange factor for the Rho GTPase Cdc42, in the mechanism of caveola endocytosis in endothelial cells (ECs). Immunoprecipitation and co-localization studies showed that ITSN-2L associates with members of the Cdc42-WASp-Arp2/3 actin polymerization pathway. Expression of Dbl homology-pleckstrin homology (DH-PH) region of ITSN-2L (DH-PH_ITSN-2L) induced specific activation of Cdc42, resulting in formation of extensive filopodia, enhanced cortical actin, as well as a shift from G-actin to F-actin. The “catalytically dead” DH-PH domain reversed these effects and induced significant stress fiber formation, without a detectable shift in actin pools. A biotin assay for caveola internalization indicated a significant decrease in the uptake of biotinylated proteins in DH-PH_ITSN-2L-transfected cells compared with control and 1 μm jasplakinolide-treated cells. ECs depleted of ITSN-2L by small interfering RNA, however, showed decreased Cdc42 activation and actin remodeling similar to the defective DH-PH, resulting in 62% increase in caveola-mediated uptake compared with controls. Thus, ITSN-2L, a guanine nucleotide exchange factor for Cdc42, regulates different steps of caveola endocytosis in ECs by controlling the temporal and spatial actin polymerization and remodeling sub-adjacent to the plasma membrane.

The polymerization of actin has a central role in clathrin- and caveola-mediated endocytosis (1). Studies have shown a number of protein-protein interactions that suggest a functional relationship between the actin cytoskeleton and endocytic machinery; however, the underlying mechanisms remain unclear. ITSN-2L,² a multifunctional domain protein with two Epsin 15 homology domains, a central coiled-coil region followed by five consecutive Src homology 3 domains, a Dbl homology (DH), a pleckstrin homology (PH), and finally a C2 domain, interacts via the Src homology 3 region with the ubiquitously expressed neural Wiskott-Aldrich syndrome protein (N-WASP) that stimulates actin nucleation through Arp 2/3 complex activation (2). ITSN-2L interaction with N-WASP in turn induces activation of N-WASP in a Cdc42-dependent manner (2, 3). In this way, ITSN-2L on the basis of its DH domain acts as a GEF for the small Rho GTPase Cdc42, similar to its neuronal counterpart ITSN-1L (2, 4). The DH domain of ITSN-2L shows high sequence homology with the corresponding region of ITSN-1L (5), and it possesses all the amino acid residues required for its GEF enzymatic activity (6). Both long ITSN isoforms display immediately distal to the DH domain a PH domain, which may thereby modulate the intrinsic catalytic activity of the DH region (6–8). It has been shown that the PH domain enhances up to 100-fold the DH catalytic activity for some Dbl proteins compared with that measured for DH alone in vitro, whereas for other Dbl proteins the presence of the PH domain negatively regulates GEF activity of the DH region (9). This latter function is apparently mediated by interactions with phosphoinositides (7, 9). However, the PH sequence was shown to be dispensable for GEF activity of ITSN-2L in vitro, but it enhanced the ability to activate Cdc42 in vivo (9). Despite high sequence conservation among Rho GTPases, long ITSN isoforms apparently induce selective activation of Cdc42 due to the overall increasing size of the specificity residues of the GTPases (Cdc42 < Rac1 < RhoA) and the inability of ITSN to accommodate in an analogous position the larger size amino acid chains found in Rac1 and RhoA (10).

ITSN-2L, like its alternatively spliced short isoform, is widely expressed in human tissue, and it shows subcellular distribution similar to components of the endocytic machinery (5). In COS-7 cells overexpressing ITSN-2 isoforms, clathrin-mediated transferrin uptake was blocked, consistent with their involvement in the regulation of clathrin-mediated endocytosis (5). By contrast, ITSN-2L overexpression in Jurkat cells stimulated T cell antigen receptor (TCR) internalization, whereas truncated ITSN-2L, deleted for the DH domain, caused significant inhibition of TCR internalization (2). The stimulatory effect of ITSN-2L on TCR endocytosis may be secondary to the ability of ITSN-2L to bind through its Src homology 3 domains the proline-rich domain of N-WASP followed by Cdc42-mediated actin polymerization (2). Although more work is needed to clarify these inconsistencies, both of these studies suggest that ITSN-2L may regulate endocytosis and function cooperatively with N-WASP and Cdc42 to link WASP-mediated actin polymerization to the endocytic machinery (2).

Live cultured fibroblast imaging showed that actin polymerization as regulated by the WASP-Arp2/3 complex participates in the late stage of clathrin-mediated endocytosis (11). Therefore, we reasoned that ITSN-2L, as a specific activator of Cdc42, may be essential for actin cytoskeleton polymerization and caveola internalization in ECs. ECs are particularly rich in caveola, and caveola-mediated endocytosis is a fundamental step in mediating the transcytosis of proteins (12, 13), but the mechanisms of caveola-mediated endocytosis and the essential proteins involved remain enigmatic. In this study, we addressed the role of ITSN-2L in the mechanism of caveola internalization in ECs. Our data employing morphological, biochemical, and functional approaches show that ITSN-2L on the basis of Cdc42-mediated spatial actin polymerization is required in the mechanism of caveola-mediated endocytosis.

EXPERIMENTAL PROCEDURES

Cell Culture and Transfection

Human lung microvascular ECs (Clonetics) were cultured with EGM^TM-2 MV (Cambrex, Walkersville, MD). FuGENE HD transfection reagent (Roche Applied Science) was used for Myc-His-tagged DH-PH_ITSN-2L and “catalytically dead” ITSN-2L-DH-PHΔΑΑ1339–1347(DH-PHΔ-(1339–1347)) transfection of ECs per the manufacturer's instructions. Preliminary experiments were carried out to establish optimized transfection and cell culture conditions. For specific silencing of ITSN-2L isoform, custom-generated Dharmacon SMARTpool siRNA reagents were used. The individual siGENOME duplex most efficient in knocking down ITSN-2L protein expression, GCACGGAUUCCUCUUCAAUUU (sense sequence) and 5′-PAUUGAAGAGGAAUCCGGCUU (antisense), was delivered using Dharmafect2 transfection reagent. RNase-free conditions were used throughout the silencing experiments. All controls for efficient transfection and to evaluate any off-target effects caused by ITSN-2L siRNA in ECs were performed as in Ref. 14. The Dharmacon siCONTROL^TM functional, nontargeting siRNA sequence 1 (5′-UAGCGACUAAACACAUCAAUU-3′) and sequence 2 (5′-UAAGGCUAUGAAGAGAUACUU-3′) were used as controls for secondary effects caused by ITSN-2L siRNA transfection. These two controls interact with the RNA-induced silencing complex but lack sufficient homology with any known human gene to effectively induce mRNA knockdown. siGlo cyclophilin B siRNA, a silencer with a fluorescent modification, was used to monitor transfection efficiency.

Generation of DNA Constructs

Myc-His-ITSN-2L-DH-PH Construct

Full-length human ITSN-2L cDNA was used as a template for PCR with DNA polymerase Pfu (Stratagene, La Jolla, CA) to generate C-terminal Myc-His-tagged DH-PH domain (residues 1212–1534). ITSN-2L cDNA was kindly provided by Dr. Suzana de la Luna (Medical and Molecular Genetics Center, IRO, Barcelona, Spain). Primer pair ITSN2L-DH-F, 5′-AGTAGAATTCGCCACCATGGCATATATTCATGAGCTGATTCAGAC-3′, and ITSN2L-DH-R, 5′-ACTTATCTAGACTCAGACGCCGCCTTGATCTTC-3′, were used to generate the DH-PH domain of ITSN-2L that lacks the stop codon. The PCR cycling conditions were as follows: initial denaturation 98 °C for 30 s, 30 cycles of denaturation, annealing, and extension; 94 °C for 3 min, 25 cycles of denaturation, annealing, and extension; 94 °C for 30 s, 58 °C for 30 s, and 72 °C for 1 min 15 s, followed by final extension 72 °C for 7 min. The resulting PCR fragment was digested with restriction enzymes EcoRI and XbaI (Invitrogen) and subcloned into the EcoRI-XbaI restriction sites of pcDNA6/Myc-His A (Invitrogen), resulting in the construct pcDNA6A-ITSN2L-DH-PH, which was verified for sequence integrity through DNA sequencing.

Myc-His-ITSN-2L-DH-PH-ΔAA1339–1347 Construct (DH- PHΔ-(1339–1347))

Full-length human ITSN-2 cDNA was used as a template for PCR with High Fidelity DNA polymerase Phusion (Finnzymes Oy, Espoo, Finland) to generate C-terminal Myc-His-tagged DH-PH domain (residues 1212–1534) with residues 1339–1347 deleted. The deleted residues corresponded to the following amino acid sequence “GMPLSSFLL.” To delete this region, a two-step PCR method was used. In the first step, two separate reactions with primer pairs ITSN2L-DH-F and ITSN2L-del AA1339–47-R or ITSN2L-del AA1339–47-F and ITSN2L-DH-R were used to generate PCR fragments that flanked the deleted region. The primers used contained overlapping sequence that flanked the deleted residues. The resulting PCR fragments were analyzed by gel, purified, and used as overlapping DNA templates for the 2nd PCR step with primers ITSN2L-DH-F and ITSN2L-DH-R. The sequence of the primer pair that flanked the deleted region were as follows: ITSN2L-del AA1339–47-F, 5′-CGGTGTAAA|AAACCCATGCAGAGGATCAC-3′, and ITSN2L-del AA1339–47-R, 5′-CATGGGTTT|TTTACACCGCGGGTCAGATGCCAG-3′ (the line between the base pairs in the primers indicates the deleted region). The PCR cycling conditions were as follows: initial denaturation 98 °C for 30 s, 30 cycles of denaturation, annealing, and extension; 98 °C for 10 s, 67 °C for 30 s, and 72 °C for 15 s, followed by a final extension 72 °C for 10 min. The final PCR product, which lacked the stop codon, was digested with EcoRI and XbaI (New England Biolabs, Ipswich, MA) and ligated into the EcoRI and XbaI sites of pcDNA6/Myc-His A (Invitrogen), resulting in the construct pcDNA6A-ITSN2L-DH-PH-ΔAA1339–1347, which was verified for sequence integrity through DNA sequencing. Cytomegalovirus-driven dominant active Cdc42 (V12) was a gift from Dr. Tatyana Voyno-Yasenetskaya (University of Illinois, Chicago).

RT-PCR

RNA was isolated from mouse lung or cultured ECs using the RNeasy mini RNA isolation kit (Qiagen). RT-PCR was performed using ThermoScript Two-step RT-PCR kit (Invitrogen).

Immunoprecipitation

Cells were lysed in 20 mm Hepes-KOH, pH 7.4, 1.5% Triton X-100, 100 mm KCl, 2 mm dithiothreitol, 2 mm EDTA, and protease inhibitors (Roche Applied Science) for 1 h and 30 min at room temperature. Protein content was determined using MicroBCA assay (Pierce). 500 μg of total protein were then incubated with 2 μg of a control nonspecific IgG, ITSN-2L or N-WASP pAb (Cytoskeleton, Denver, CO), for 1 h at 4 °C. 40 μl of protein A/G bead slurry were then added, and the mixtures were incubated end-over-end at 4 °C overnight. The bound proteins were resolved on 5–20% SDS-PAGE. For identifying the immunoprecipitated proteins by Western blotting, primary Abs were used in conjunction with the appropriate IgG TrueBlot horseradish peroxidase-conjugated reporters (EBioscience, San Diego), designed for detection of the immunoblotted target proteins without detection of light and heavy chains of the immunoprecipitating immunoglobulin.

Immunofluorescence

ECs grown on glass coverslips or PM patches were immunostained as in Ref. 15. For phalloidin Alexa Fluor 488 staining, control or transfected cells were fixed in 3.7% paraformaldehyde (PFA) in phosphate-buffered saline for 15 min at room temperature, permeabilized in 0.1% Triton X-100 for 5 min on ice, and stained with 25 μg/ml phalloidin Alexa Fluor 488 for 30 min at room temperature. Cells were mounted with Prolong Antifade reagent (Molecular Probes). Images were acquired on a Zeiss Axioplan2 with Neofluor 100× objective (1.3 N.A.), using the AxioCam with AxioVision 4.6 software.

Actin Polymerization Assay

Analysis of actin polymerization was performed as in Ref. 16. Briefly, ECs were washed in phosphate-buffered saline, scraped, and collected into 1.5-ml Eppendorf tubes. Cell pellets were then resuspended in 100 μl of Lysis Buffer I (20 mm Hepes-NaOH, pH 7.2, 100 mm NaCl, 1 mm sodium orthovanadate, 50 mm NaF, 1% Triton X-100, 1× protease inhibitors) for 1 h and then centrifuged for 20 min at 10,000 × g. Supernatants were saved as the G-actin fractions, and the pellets were resuspended in Lysis Buffer II (15 mm Hepes-NaOH, pH 7.5, 0.15 mm NaCl, 1% Triton X-100, 1% sodium deoxycholate, 0.1% SDS, 10 mm EDTA, 1 mm dithiothreitol, 1 mm sodium orthovanadate, protease inhibitors) for 1 h. The mixtures were then centrifuged at 45,000 rpm in a Beckman Optima^TM TLX ultracentrifuge for 40 min. The ensuing supernatants represented the F-actin fractions. Equal protein amounts were loaded onto 4–12% SDS-PAGE. Actin was detected by immunoblotting with anti-actin Ab (Cytoskeleton) and quantified by densitometry using ImageJ1.37v software.

Cdc42/Rac1/RhoA Activation Assay

Assays were performed as instructed using Cdc42 activation assay biochem kit (Cytoskeleton, Denver, CO). Briefly, cells were scraped with ice-cold lysis buffer and centrifuged to remove cell debris. Cell lysates were then incubated with 20 ml of PAK-GST beads for Cdc42/Rac or 50 ml of Rhotekin-GST beads for Rho for 90 min at 4 °C. Beads were washed three times with wash buffer. Beads were boiled for 5 min in 20 μl of Laemmli buffer; samples were run in parallel with total cell lysate and immunoblotted with Abs to the appropriate small GTPase. Activation of Cdc42, Rac1, and RhoA in control and transfected cells was determined by densitometry, with total lysate used to normalize the total amount of small GTPase protein.

RESULTS

ITSN-2L Is Expressed in ECs and Interacts with Protein Components of the Cdc42/N-WASP/Arp2/3 Actin Polymerization Pathway

We first investigated the expression and subcellular localization of ITSN-2L in cultured ECs. Western blot of EC lysates using a rabbit polyclonal Ab (anti-ITSN pAb₈₁₁₇₇) raised against a GST fusion protein comprising the N-terminal 440 amino acids of human ITSN-1 (as in Ref. 14) showed two bands corresponding to the short (140 kDa) and long (190 kDa) ITSN isoforms (Fig. 1A). As immunoblot analysis did not distinguish between splice variants of ITSN-1 and ITSN-2, we used RT-PCR with specific primers for ITSN-1s, ITSN-1L, ITSN-2s, and ITSN-2L to investigate the presence of mRNA for the two ITSN-2 isoforms. Both ITSN-2s and ITSN-2L mRNA were detected in ECs (Fig. 1B). In addition, RT-PCR showed mRNA for ITSN-1s but not for the neuron-specific ITSN-1L (17). The specific primer for ITSN-1L detected this isoform in mouse brain lysate (data not shown). Immunofluorescence staining using an effective anti-ITSN-2L pAb (Santa Cruz Biotechnology, Inc.) revealed a diffuse staining and strong numerous puncta throughout the cytosol (Fig. 1C, panels c1 and c3) and at the PM level (Fig. 1C, panel c2, arrows). This observation suggests that ITSN-2L, a protein without a transmembrane domain, is present not only in the EC cytosol but also associated with vesicular structures.

FIGURE 1.

ITSN-2L expressed in ECs interacts with protein members of N-WASP-Arp2/3 actin polymerization pathway. A, Western blotting using anti-ITSN pAb₈₁₁₇₇ shows expression of short and long ITSN isoforms in cultured lung ECs. Mr, molecular weight protein standards. B, RT-PCR shows relative amounts of mRNA for ITSN isoforms in ECs. C, representative micrographs of ECs immunostained with anti-ITSN-2L-specific pAb show the subcellular distribution of ITSN-2L (panel c1) and in detail the punctate staining pattern at the PM level (panel c2, arrows) and in the cytosol (panel c3). D, immunoprecipitation with anti-ITSN pAb₈₁₁₇₇ revealed ITSN (lane c) interactions with Cdc42 (lane d), Arp2/3 complex (lane e), and N-WASP (lane f). Two nonspecific Abs, anti-rabbit IgG (lane a) and anti-rat IgG (lane b), did not immunoprecipitate these proteins. Immunoprecipitation using N-WASP pAb demonstrated similar interactions, ITSN isoforms (lane g), Cdc42 (lane h), Arp 2/3 (lane i) and N-WASP (lane j). Bars, 20 μm (panel c1); 10 μm (panels c2 and c3).

Since in other cell types ITSN-2L has been linked with N-WASP regulators of actin cytoskeleton, we investigated if in ECs ITSN-2L interacts with essential proteins for actin polymerization and actin-mediated mobility, such as N-WASP, Arp2/3, and Cdc42 (18–20). We used total ECs lysates and anti-ITSN pAb₈₁₁₇₇ for co-immunoprecipitation studies. Anti-ITSN pAb co-immunoprecipitated endothelial ITSN isoforms (Fig. 1D, lane c) and additional proteins were identified by immunoblotting as Cdc42 (lane d), Arp2/3 (lane e), and N-WASP (lane f). Control nonspecific rabbit IgG and rat IgG did not bring down these proteins (Fig. 1D, lanes a and b). The same protein-protein interactions were detected when anti-N-WASP pAb was used for immunoprecipitation (Fig. 1D). Next, we analyzed by double immunofluorescence on PM patches the co-localization of ITSN-2L with cav-1, N-WASP, and Arp2/3. Endothelial PM patches bearing attached caveolae allowed us to determine with high resolution the distribution of these protein pairs on the PM, the site of caveola endocytosis. PM patches were generated by brief sonication of endothelial monolayers grown on poly-lysine-coated coverslips as described previously (21). As shown in Fig. 2A, freshly prepared PM sheets, fixed with 4% PFA and immunostained with anti-ITSN-2L pAb, showed the nano-domain distribution similar to cav-1, a reliable marker for the caveola microdomains on the PM sheets (21). The overlapped images show limited cav-1/ITSN-2L co-localization, suggesting that only part of the PM-associated ITSN-2L is localized in caveolae. Similar punctate pattern and a greater degree of co-localization with ITSN-2L were revealed by anti-N-WASP and anti-Cdc42 Abs (Fig. 2, merged panels). To determine the spatial coordination between cav-1 and protein members of the actin polymerization pathway, we performed tri-color imaging (Fig. 2B) of PM patches as described previously (21). Morphometric analysis of overlapped images indicated a similar degree of association between N-WASP/cav-1 (13 ± 4%) and Arp3/cav-1 (15 ± 4%). In 22 ± 7% (mean ± S.D., n = 10 PM patches) of co-localization events, all three proteins were found together. About 50% of cav-1 positive puncta did not co-localize with either N-WASP or Arp-2 or it was not possible to determine their co-localization. Fig. 2B, panels b1–b8, shows representative images used to score for co-localization of cav-1 with Arp2/3 (panels b1 and b3), with N-WASP (panels b4–b6), and with both Arp2/3 and N-WASP (panels b7 and b8). Co-localization of the three proteins was also considered to have occurred when cav-1-positive puncta overlapped on either side of the Arp2/3/N-WASP immunoreactive spots (Fig. 2B, panel b8). These observations indicate that a fraction of the PM-located ITSN-2L and proteins of the N-WASP-Arp2/3 complex actin polymerization pathway are localized in close proximity of the caveolar microdomains, suggesting that ITSN-2L-mediated localized actin polymerization occurs in a spatially and temporally coordinated manner at the level of the endothelial PM caveolae.

FIGURE 2.

ITSN-2L co-localizes with protein members of Cdc42/N-WASP-Arp2/3 complex actin polymerization pathway. A, PM patches immunostained with ITSN-2L pAb show bright fluorescent puncta. Double fluorescent staining with cav-1, N-WASP, and Arp2/3 Abs indicated partial co-localization. Higher magnification of the boxed areas shows a pool of PM-associated ITSN-2L co-localizing with cav-1 and significant co-localization of ITSN-2L with WASP and Arp2/3 complex. B, representative PM patch triple fluorescently stained for cav-1, N-WASP, and Arp2/3 complex were viewed sequentially through optical filter sets for the fluorophores used, and the resulting images were overlapped. Co-localization was scored as follows: for cav-1/Arp-2/3 (yellow, panels b1–b3), for cav-1/N-WASP (purple, panels b.4–b6), and for cav-1/Arp2/3/N-WASP (white, panel b7). Co-localization of the three proteins was also considered when cav-1-positive puncta overlapped on either side of the Arp2/3/N-WASP immunoreactive spots (panel b8). The extensive overlapping detected on the edge of the PM patch was not used for quantification. All images used for quantification were acquired using identical parameters per experiment. Bars, 5 μm.

DH-PH_ITSN-2L Domain Specifically Activates Cdc42

To investigate the role of ITSN-2L in caveola endocytosis, we analyzed the morphological and functional effects of DH-PH_ITSN-2L expression in ECs, a common approach used to assess functions of multimodular proteins (22, 23). This approach allowed us to investigate the effects exclusively ascribed to the DH-PH domain, thus eliminating influences of neighboring sequences. We transiently transfected subconfluent ECs with the Myc-tagged DH-PH_ITSN-2L, to assess the catalytic specificity of DH-PH_ITSN-2L in the mechanism of Cdc42 activation and actin polymerization. Although the PH domain does not have an effect on the DH function, it may play an important role in its proper location (4). Ectopically expressed DH-PH_ITSN-2L was detected by fluorescence microscopy and in total ECs lysates with anti-Myc mAb, at 48 h post-transfection (Fig. 3A). Morphometric analysis performed on transfected EC monolayers immunostained with Myc mAb followed by anti-mouse IgG Alexa Fluor 488-conjugated indicated an average of 75 ± 5% transfection efficiency. To determine the ability of DH-PH_ITSN-2L to activate Cdc42, control and transfected ECs were subjected to GST pulldowns using the Pak-PBD binding domain, which only interacts with active Cdc42 and Rac1. Similarly, for RhoA activation, GST pulldown was carried out using rhotekin-GST beads. Expression of DH-PH_ITSN-2L in ECs increased Cdc42 activity 71%, compared with controls, but did not affect Rac1 or RhoA activity (Fig. 3, B and C).

FIGURE 3.

DH-PH_ITSN-2L expression selectively activates Cdc42 in ECs. A, expression of myc-DH-PH_ITSN-2L in ECs was monitored by immunofluorescence and Western blot with anti-Myc mAb. B, DH-PH_ITSN-2L expression stimulated formation of active Cdc42-GTP. No activation of Rac1 or RhoA was detected. Data are representative of three independent experiments. C, quantitative analysis of Cdc42, Rac1, and RhoA activation by densitometry. D, phalloidin-488 staining of PFA-fixed control, DH-PH_ITSN-2L, and DA-Cdc42 transfected ECs to visualize polymerized actin. Control cells exhibit polygonal shape, intact junctions, cortical actin band, and some stress fibers. DH-PH_ITSN-2L-transfected ECs demonstrate formation of filopodia (panels d2 and d4, arrows) and significant increase of cortical actin (panels d2 and d4, arrowheads), as well as inter-endothelial junctional gap formation (panel d2, asterisk). The cytoskeletal changes seen in DH-PH_ITSN-2L-transfected cells are reminiscent of cytoskeletal changes seen upon transfection with DA-Cdc42 (panel d3). E, biochemical and densitometric analysis of G- and F-actin in control and transfected ECs as well as 1 μm Jasp-treated ECs. Data were collected from 3 to 4 different experiments. Bars, 10 μm.

Given that ITSN-2L activity toward Cdc42 via the DH-PH_ITSN-2L may spatially regulate actin polymerization, we next analyzed the effects of DH-PH_ITSN-2L on actin organization, using phalloidin-Alexa 488 labeling. Control ECs displayed a polygonal shape with actin microfilament bundles forming the dense peripheral band and some stress fibers (Fig. 3D, panel d1), whereas transfected cells exhibited increased polymerized actin seen as a wider cortical actin layer with accumulation of F-actin (Fig. 3D, panel d2, arrowheads) and appearance of filopodia (Fig. 3D, panels d2 and d4, arrows). We also observed appearance of gaps between ECs (Fig. 3D, panel d2, asterisk), suggesting that expression of DH-PH_ITSN-2L and resultant Cdc42 activation and actin remodeling affect the integrity of interendothelial junctions (IEJs). To substantiate that the recorded cytoskeletal changes are because of ITSN-2L-induced Cdc42 activation, we transfected ECs with V12-Cdc42, a dominant active form of Cdc42. Phalloidin-Alexa 488 staining showed similar distribution of filamentous actin and disrupted IEJs (Fig. 3D, panel d3). Under the conditions of our experiment, the length of filopodia in ECs expressing the activated Cdc42 is significantly shorter and may be due to the fact that Cdc42 activity induces activation of endogenous Rac, which in turn activates Rho (24). These events do not occur in DH-PH_ITSN2L-transfected cells (Fig. 3C).

Biochemical analysis of changes in actin polymerization as described previously (16) showed significant shift from G-actin to F-actin in DH-PH_ITSN-2L-transfected cells by reference to controls (Fig. 3E). As assessed by densitometry, in controls, the amount of G-actin and F-actin was similar, whereas in DH-PH_ITSN-2L-transfected cells the F-actin content was increased (Fig. 3E). Together, these results support our hypothesis that ITSN-2L, by specifically activating Cdc42, stimulates actin nucleation and polymerization through N-WASP, a substrate for activated Cdc42.

The specificity of DH-PH activity was also evaluated by transfection of subconfluent EC monolayers with the DH-PHΔ-(1339–1347), an ITSN-2L construct comprising a catalytically dead DH-PH region. The mutation involves several amino acids essential for the catalytic activity (7, 10). Transfected ECs were then subjected to morphological and biochemical analyses to evaluate the status of cellular actin and activation of Cdc42. The defective DH-PHΔ-(1339–1347) domain suppressed Cdc42 activation (Fig. 4A and B) and filopodia formation (Fig. 4C). Infrequently, we still noticed short membrane protrusions (Fig. 4C, panel c1). Transfected ECs became elongated (Fig. 4C, panel c1), and filamentous actin shifted from the cortical pool to only stress fibers (Fig. 4C, panels c1 and c2). Morphometric analysis indicated that about 70% of the ECs immunoreactive to Myc Ab, and thus transfected with the catalytically dead DH-PHΔ-(1339–1347) domain, show enhanced stress fiber formation (Fig. 4D). Biochemical analysis of cellular actin (Fig. 4E) and densitometric analysis (Fig. 4F) did not reveal any significant change between F- and G-actin pools in DH-PHΔ-(1339–1347)-transfected cells by reference to controls. These results suggest that Cdc42 activity as regulated by the DH-PH domain of ITSN-2L, a GEF for Cdc42, controls the distribution of F-actin between cortical dense band and stress fibers in ECs.

FIGURE 4.

DH-PHΔ-(1339–1347) expression decreases Cdc42 activation and causes enhanced stress fiber formation. A, DH-PHΔ-(1339–1347) expression inhibits formation of active Cdc42-GTP. B, quantitative analysis of Cdc42 activation by densitometry. C, phalloidin-488 staining of PFA-fixed DH-PHΔ-(1339–1347)-transfected ECs to visualize polymerized actin (panel c1). DH-PHΔ-(1339–1347)-transfected ECs demonstrate enhanced formation of stress fibers (panel c1 and c2), lack of cortical actin, as well as presence of disrupted IEJs. D, morphometric analysis of the extent of stress fiber formation in DH-PHΔ-(1339–1347)-transfected ECs. E and F, biochemical and densitometric analysis of G- and F-actin in control and transfected ECs as well as DH-PH-(1339–1347)-transfected ECs. Data are representative of 3–4 independent experiments. Bar, 20 μm (panel c1); 10 μm (panel c2).

Increased Actin Polymerization Induced by the DH-PH_ITSN-2L Domain Interferes with Caveola Internalization

The functional effects of DH-PH_ITSN-2L expression on caveola internalization were studied in ECs transfected with the DH-PH_ITSN-2L, at 48 h post-transfection. Caveola internalization, followed by biochemical and morphological analyses were carried out as described previously (15). Briefly, control and transfected cells were subjected to biotinylation of cell surface proteins using a cleavable biotin reagent. In ECs the internalization of biotinylated cell surface proteins is mediated primarily by caveolae (15). After 30 min of internalization, biotinylated proteins still on the cell surface were reduced with glutathione, a membrane-impermeant reducing reagent (25). For morphological analysis by fluorescence microscopy, the internalized proteins were detected by NeutrAvidin-Texas Red staining. Control cells show a strong fine punctate staining throughout the cytoplasm with significant accumulation of biotin in the perinuclear area (Fig. 5A, a1 and a1.1). In contrast, DH-PH_ITSN-2L-transfected ECs exhibited markedly limited staining with no perinuclear accumulation (Fig. 5A, a2 and a2.1). Quantitative assessment of internalized biotinylated proteins in control and transfected ECs lysates by enzyme-linked immunosorbent assay (ELISA) using streptavidin-horseradish peroxidase indicated that control cells internalized 19.2 × 10¹⁴ ± 1.9 biotin molecules/mg of total protein, whereas DH-PH_ITSN-2L-transfected ECs internalized 7.3 × 10¹⁴ ± 0.9 biotin molecules/mg of total protein (Fig. 5B). The limited NeutrAvidin Texas Red staining and the 63% decrease in the amount of internalized biotin in cells transfected with DH-PH_ITSN-2L by reference to controls indicate a central role of actin nucleation and actin polymerization (sub-adjacent to the PM) induced by Cdc42 activation in regulating caveola internalization. To substantiate this observation, we used the cell-permeant cyclic peptide Jasp for inducing polymerization and stabilizing actin filaments (26). Although structural changes caused by 1 μm Jasp treatment were distinct from those induced by DH-PH_ITSN-2L (not shown) and the shift from G-actin to F-actin was significantly greater (Fig. 3E), NeutrAvidin Texas Red staining was limited (Fig. 5A, a3 and a3.1) and caveola internalization reduced by 20% (Fig. 5B). The smaller reduction in caveola internalization following 1 μm Jasp treatment by comparison with DH-PH_ITSN-2L-transfected cells suggests that overall augmented actin polymerization per se is not responsible for inhibiting caveola internalization. Instead, temporal and spatial actin polymerization and remodeling sub-adjacent to the PM induced by DH-PH_ITSN-2L are crucial in inhibiting caveola endocytosis.

FIGURE 5.

Experimental manipulation of ITSN-2L protein expression causes actin cytoskeletal redistribution that interferes with caveola internalization. A, control (A, panels a1 and a1.1), DH-PH_ITSN-2L (A, panels a2 and a2.1), and 1 μm Jasp-treated (A, panels a3 and a3.1) ECs subjected to internalization assay followed by NeutrAvidin Texas Red staining show strong puncta throughout the cytoplasm, with prominent perinuclear accumulation (panels a1 and a1.1), whereas DH-PH_ITSN-2L-transfected (panels a2 and a2.1) or 1 μm Jasp-treated cells (panels a3 and a3.1) displayed limited staining and no perinuclear accumulation of biotin. B, number of biotin molecules in EC lysates from control, DH-PH_ITSN-2L-transfected cells, Jasp-treated ECs, and ITSN-2L siRNA was determined by ELISA in 3–4 experiments for each experimental condition. Data are calculated as number of biotin molecules/mg of total protein/min and plotted as percentage from control. Bar, ± S.D. C, Western blot analysis of ITSN isoforms protein expression using anti-ITSN pAb₈₁₁₇₇ in controls and ITSN-2L siRNA-treated cells; MW, molecular weight protein standards. D, densitometric analysis of ITSN immunoreactivity in controls and siRNA-transfected ECs. E, RT-PCR analysis of mRNA levels for ITSN isoforms in controls (lane a), control siRNA (lane b), and ITSN-2L siRNA-transfected ECs (lane c). F, control (panel f1) and siRNA ITSN-2L-transfected ECs (panel f2) were subjected to internalization assay. ECs depleted of ITSN-2L (panel f2) show strong punctate staining similar to controls (panel f1). Because of excessive perinuclear accumulation of biotin-labeled proteins in ECs deficient in ITSN-2L, both control and ITSN-2L siRNA-transfected ECs were subjected to only 15 min of internalization. Bars, 10 μm (panels a1, a2, and a3); 5 μm (panels a1.1, a2.1, and a3.1); 10 μm (panels f1 and f2).

ITSN-2L-deficient ECs Show Prominent Changes in F-actin Distribution and Increase in Caveola Internalization

To examine the consequences of ITSN-2L deficiency in caveola endocytosis, we applied an siRNA approach. We used Dharmacon custom SMARTpool reagents comprising four different siRNA oligonucleotides designed for specific and efficient down-regulation of ITSN-2L gene expression in ECs. Efficient down-regulation was achieved at 72 h post-siRNA transfection, as detected by Western blot analysis of total lysates prepared from control and siRNA-transfected cells (Fig. 5C). Densitometric analysis of immunoreactive bands (Fig. 5D) indicated about 75–85% decrease of ITSN-2L protein expression compared with nontransfected ECs and ECs transfected with the siCONTROL^TM functional and nontargeting siRNA sequences. ITSN-2L siRNA oligonucleotide 1 was the most efficient and was used in all studies performed. RT-PCR analysis of RNA extracted from ECs 72 h post-siRNA treatment, as described previously (14), also indicated a specific silencing of ITSN-2L gene expression (Fig. 5E, lane c). ITSN-2L siRNA transfection down-regulated ITSN-2L but had no effect on mRNA of the other two ITSN isoforms expressed by lung ECs. Fluorescence microscopy analysis of ECs monolayers transfected with 100 nm siGlo cyclophilin B siRNA showed numerous cells with perinuclear punctate fluorescent staining at 48 h post-transfection, indicative of high efficiency of siRNA transfection (data not shown).

Next, we applied the biotin assay for caveola internalization to both control (Fig. 5F, panel f1) and ECs depleted of ITSN-2L (Fig. 5F, panel f2) as described above. Biotin-NeutrAvidin staining indicated a strong punctate pattern throughout the cell under both experimental conditions. Quantification by ELISA of the biotin amounts internalized by ITSN-2L siRNA-transfected cells indicated a 62% increase in internalization of biotinylated cell surface proteins relative to controls (Fig. 5B).

To gain insights into the functional effects of ITSN-2L deficiency, we analyzed the status of cellular actin in control (Fig. 6A, panel a1) and ITSN-2L siRNA-transfected ECs (Fig. 6A, panels a2 and a3) by phalloidin-Alexa 488 labeling. Down-regulation of ITSN-2L led to marked changes in EC shape and F-actin distribution. ITSN-2L-depleted cells lost their polygonal shape and became elongated with numerous intercellular gaps. The dense peripheral actin bands were disorganized and disrupted. Dense organized network of stress fibers present throughout the cytoplasm and aligned with the long axis of the cell became the most prominent actin structure (Fig. 6A, panel a3). Similar shift from cortical actin to stress fibers due to lack of Cdc42 activity and some filopodia formation were seen in the DH-PHΔ-(1339–1347)-transfected ECs.

FIGURE 6.

ITSN-2L depletion causes F-actin re-distribution and decreases Cdc42 activation. A, phalloidin-488 staining of PFA-fixed control (panel a1) and ITSN-2L siRNA-transfected ECs (panel a2). Control cells exhibit polygonal shape, intact junctions, cortical actin band (arrows), and some stress fibers (arrowheads), whereas transfected cells are elongated and have disorganized cortical actin and enhanced stress fiber formation (panels a2 and a3). B, GST pulldowns for Cdc42, Rac1, and RhoA activation followed by Western blotting. C, densitometry quantification shows a decrease of Cdc42 activation upon depletion of ITSN-2L. Bars, 50 μm (panels a1 and a2) 10 μm (panel a3).

To determine whether actin cytoskeletal changes were associated with activation of small Rho GTPases, we performed activity assays for Cdc42, Rac1, and Rho (Fig. 6B). Densitometric analysis of blots from three different experiments indicated that depletion of ITSN-2L caused a quantitative decrease in Cdc42 activation (Fig. 6C). However, the relative activities of Rac1 and RhoA remained the same. Our findings showing that disorganization of cortical actin network correlated with abundant and thicker stress fibers and with no shift between F-and G-actin support the hypothesis that ITSN-2L controls the localized architectural organization of actin filaments in ECs.

DISCUSSION

To investigate the functional importance of ITSN-2L in caveola endocytosis, we first analyzed the morphological and functional effects of DH-PH_ITSN-2L expression in ECs, a common approach to assess the function of multimodular proteins (22, 23). The approach allowed us to investigate the effects exclusively ascribed to the DH-PH domain, thus eliminating the possible influence or regulatory effects of the neighboring sequences. Under conditions of adequate expression and subcellular localization, the DH-PH fragment promoted specific activation of Cdc42 and augmented actin polymerization. The DH-PH_ITSN-2L-transfected cells displayed a wider peripheral actin band, numerous filopodia-like structures, and disruption of IEJs. Moreover, the trafficking of caveolae is inhibited indicating that the wider and perhaps the denser cortical network of actin functions as a molecular barrier, preventing the inward movement of caveolae. The transport of caveolae away from the PM may require changes in F-actin, with local actin remodeling and possibly depolymerization to facilitate caveola movement. Consistent with this idea, stabilization of actin filaments by treatment of ECs with Jasp, a cyclic peptide that binds to and stabilizes filamentous actin in vitro and enhances actin polymerization in vivo (27), may explain the observed inhibition of caveola internalization. Furthermore, because the PM of all cells is linked to an underlying actin cytoskeleton, augmented actin polymerization at this level may cause increased rigidity of the PM that may affect caveola formation. These observations strongly suggest that actin polymerization processes must be the subject of an especially fine temporal and spatial coordination to facilitate caveola endocytosis.

We also show that siRNA-mediated ITSN-2L knockdown causes a significant decrease in Cdc42 activation that coincides with significant remodeling of actin cytoskeletal organization. Interestingly, disorganization of the dense peripheral actin band triggered the increase of caveola internalization. ITSN-2L deficiency removed the cortical actin network assumed to control caveola trafficking, and thus led to the recorded up-regulation of caveola internalization. Moreover, ITSN-2L deficiency may cause weakening of the PM-associated actin cytoskeleton and less membrane rigidity favoring caveola formation. These results suggest that in ECs ITSN-2L is required for the organization of cortical actin as peripheral dense band and actin membrane cytoskeleton. Interestingly, the catalytically dead DH-PH domain, which compromised significantly activation of Cdc42 in DH-PHΔ-(1339–1347)-transfected cells, caused a dramatic shift of F-actin pools from cortical actin band to stress fibers. The disorganization of cortical actin network correlated with abundant and thicker stress fibers, and no shift between F-actin and G-actin strongly suggests that ITSN-2L, as a GEF for Cdc42, may control the cellular distribution and architectural organization of actin filaments in different subcellular scaffolds. Whereas the effect of ITSN-2L siRNA likely reflected a selective cytoskeletal action, it would have been too naive to consider that the ITSN-2L deficiency would be limited to cytoskeletal modification. ITSN-2L, similar to its neuronal counterpart, may bind a plethora of regulatory molecules, interactions that may affect the efficacy of caveola internalization. ITSN-2L may bind dynamin that interacts with the actin machinery via cortactin and syndapin (28–30). Both dynamin and N-WASP interact via their proline-rich domains with subsets of the Src homology 3 domains of ITSN-2L (2), an observation that raises the possibility of competitive binding and thereby, the possibility of ITSN-2L as a molecular control for both caveola endocytic function and actin polymerization. Alternatively, ITSN-2L may hetero-oligomerize via the central coiled-coil region with the other two endothelial ITSN isoforms and work synergistically by controlling the recruitment of dynamin at the neck region of caveolae. Because ITSN isoforms and their splice variants have a distinct expression pattern (5, 17), they may also play isoform-specific functions, which are still to be determined.

We conclude that changes in actin polymerization, as regulated by experimental manipulation of ITSN-2L protein expression, may compromise caveola endocytosis, indicating that efficient caveola endocytosis requires a finely tuned coupling of caveola endocytic function and actin polymerization machinery. ITSN-2L is a universally expressed GEF for Cdc42 and displays some distinctiveness that makes it an ideal candidate to functionally link Cdc42 activation and subsequent actin polymerization to caveola endocytosis.