| Primer | Sequence | Nucleotides | |
| Origin | Forward | tcaaaatgcagcattatattttaagct | 7867-297 |
| Primer Set A | Reverse | tggaacaccttgccaaagtcttc | |
| Upstream E2 | Forward | acacccggtacacatcctgt | 7205-7685 |
| Binding Region | Reverse | ctgtctgtagtttaaggcg | |
| Primer Set B | |||
| BPV-1 LCR | Forward | aaagtttccattgcgtctgg | 7522-67 |
| Primer Set C | Reverse | gctttttctagttagctggctatttt | |
| BS 16 and 17 | Forward | ggtggtagaggtggagtttgatg | 2953-3085 |
| Reverse | agtagtagagcccagttccgtcag | ||
| L1 | Forward | atctccctccaacccctgtaag | 5638-6039 |
| Reverse | gcctgtttgtttcctgtcatctg | ||
Official websites use .gov
A
.gov website belongs to an official
government organization in the United States.
Secure .gov websites use HTTPS
A lock (
) or https:// means you've safely
connected to the .gov website. Share sensitive
information only on official, secure websites.