Figure 2.

Non-denaturing PAGE analysis of the 22wt, 22CTA and 22TCA human telomeric sequences (Table 1), which were pre-incubated in a 10 mM Tris–HCl pH 7.5 buffer supplemented with (A) 100 mM Na⁺ or (B) 100 mM K⁺, then loaded on a 15% polyacrylamide gel supplemented with 20 mM of the corresponding salt, and run at 26°C. Migration markers are provided on the left: oligothymidylate sequences (dT₁₅, dT₂₁ and dT₃₀), duplexes (dx9: d[GCGATACGG] + d[CCGTATCGC] and dx12: d[GCGTGACTTCGG] + d[CCGAAGTCACGC]), and single-stranded 22AgMut4 control sequence d[ATGGTTAGTGTTAGGTTTAGTG] incapable of forming a quadruplex. Note that with respect to the markers, 22wt, 22CTA and 22TCA human telomeric sequences migrate faster in K⁺ solution than in Na⁺ solution.