Fig. 8.

Analysis of putative FXREs in rat CAT-1 promoter. A, identification of a putative FXRE in rat CAT-1 promoter via an in silico analysis with a Web-based algorithm (NUBIScan). B, mutation of IR0 on the CAT-1 promoter eliminates activation by FXR. C, electrophoretic mobility shift assay analysis of the binding of FXR/RXR to IR0 in rat CAT-1 promoter. Double-stranded oligonucleotides (–aaggggtcatgacccactgg/–ccagtgggtcatgacccctt) were end-labeled with [γ-³²P]ATP using T4 polynucleotide kinase. The labeled probe was incubated with in vitro-translated RXR/FXR for 20 min. The reactions were analyzed by electrophoresis in a nondenaturing 5% polyacrylamide gel followed by autoradiography. In some studies, the samples were preincubated with anti-FXR antibody before gel electrophoresis. —, control.